Fill in the blanks in the table below regarding the similarities and differences between two cellular processes: DNA replication and transcription. DNA replication Transcription A separate helicase enzyme is recruited to unwind DNA (Yes/ No) Polymerase moves along the DNA template from 5' to 3' or 3' to 5? The region on DNA from which the process starts is called:

Fill in the blanks in the table below regarding the similarities and differences between two cellular processes: DNA replication and transcription. DNA replication Transcription A separate helicase enzyme is recruited to unwind DNA (Yes/ No) Polymerase moves along the DNA template from 5' to 3' or 3' to 5? The region on DNA from which the process starts is called:

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Similar questions

The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
1. How are nucleotides formed? In details summarize the process of DNA replication. In details summarize the process of Translation and post translation process. In details summarize the process of transcription. Explain how do you sequence the DNA
1. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T 3. A scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial cells. Which enzyme(s) would Dr. Doom need to target to prevent translation at the transcriptional stage? Group of answer choices a. RNA Polymerase…
1. make your own sample representation of DNA replication. Complete your representation for a single helical turn. 2. prepare a representation of how mRNA is formed in the nucleus 3. Complete to build a Polypeptide. Start from the DNA template you made , the mRNA transcript formed, and finally the processed or synthesize proteins with the aid of the Genetic code table.
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
Which of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.
4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC
1. Which of the following statements about the flow of genetic information is correct?A. Translation occurs prior to transcription during protein synthesis.B. During translation, the DNA template is converted to amino acids by the ribosomes.C. During transcription, the DNA template is converted to an RNA molecule by the enzyme RNA polymerase.D. Eukaryotic mRNA needs to be transported to the cytoplasm before the protein products are synthesized. 2. What is the main difference in the cell wall composition between eukaryotes and prokaryotes?A. Eukaryotic cell wall is mainly composed on sugar molecules while prokaryotic cell wall has both sugars and amino acids.B. Prokaryotic cell wall is mainly composed on sugar and lipid molecules while eukaryotic cell wall has both sugars and amino acidsC. Prokaryotic cell wall is mainly composed on sugar molecules while eukaryotic cell wall has both sugars and amino acids.D. Eukaryotic cell wall is mainly composed on sugar and lipid molecules while…
Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicase
1. Describe the relationship between chromosomes, cells, and DNA2. [Use Pictures] - How does the model describe about the structure of DNA3. Why do scientists use models? What are the limitations of models?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.