6. Using the concept of complementary base pairing, write the complementary DNA strands, with their 5' and 3' ends labeled, for each of the following DNA base sequences. a. 5' AGCTAT 3' b. 5' TTACCG 3' c. 3' GCATAA 5' d. AACTGG

6. Using the concept of complementary base pairing, write the complementary DNA strands, with their 5' and 3' ends labeled, for each of the following DNA base sequences. a. 5' AGCTAT 3' b. 5' TTACCG 3' c. 3' GCATAA 5' d. AACTGG

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 5TYU: If a segment of DNA is 5 CATTAC 3, the complementary DNA strand is (a) 3 CATTAC 5 (b) 3 GTAATG ...

See similar textbooks

Related questions

Q: why the hemacytometer method is not compatible with mycelium b. Explain at what stage of growth the…

A: Cell counting: Hemocytometer or cell counting chember is used for primary cell counting, where a…

Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…

A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…

Q: What ligand on transferrin is responsible for the red color of the iron loaded transferrin. please…

A: Transferrin is a 76 kDa glycoprotein which transport iron through blood plasma in Fe3+ state. It…

Q: Which of the following refers to the test performed 2 hours after an overnight-fasted patient was…

A: Different tests are used to test the blood glucose level.

Q: Under what pH conditions can a protein not bind to the beads in a column? pH = -pKa pH =…

A: Proteins are composed of amino acids. There are a total of twenty standard amino acids that make up…

Q: How are water-soluble vitamins different from fat-soluble? * (Please choose one correct answer only)…

A: Vitamins are essential nutrients required for the body to fight against diseases. There are two…

Q: Proteins are compounds composed of many _________ linked together

A: The protein which is most important constituent for every living organisms. The term protein firstly…

Q: Match the following descriptions to the given choices Synthesized from a steroid molecule A. Vitamin…

A: Vitamin is an organic substance and an essential micronutrient that an organism needs in small…

Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? O…

A: A protein is consisted of several amino acids bond together in sequence with peptide bond. To…

Q: Question 17 Which of the following is a fatty acid with this notation, 16:0 O Myristic acid Stearic…

A: In a fatty acid the notation x:y is represented by an integer where x is the number of carbon in the…

Q: The enzyme BURT was found to function at V0=250 uM/min with a Km=15.0 uM when [S]=10.0 uM. What is…

A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation…

Q: Which of the following is a drawback of using base hydrolysis during amino acid composition? A.…

A: The amino acids that occur naturally as constituents of proteins have an amino group (NH2) and a…

Q: 8. Why are histamine and serotonin contents increased in the site ol inila latory?

A: Histamine is an organic nitrogenous compound which is synthesized from amino acid residue…

Q: lycogen isolated from liver biopsy specimen had normal structure. Blood glucose level was below…

A: Introduction: Glycogen storage disease is a group of disorders that is characterized deposition of…

Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box. True False

A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…

Q: In the Biuret Assay for protein concentration determination, the role of sodium potassium tartrate…

A: The biuret test is a chemical test that can be performed to determine whether an analyte has peptide…

Q: (d) ( through the disulfide bridge. If this bridge were found for the two joined amino acids free in…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Question 4 Which is/are NOT true of protein isofor (A They have variable amino acid B They have…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl…

A: All the mentioned components are involved in signal transduction.

Q: What is the predominant attractive force that stabilizes the formation of secondary structure in…

A: The levels of structural organization of a protein are its primary structure, secondary structure,…

Q: explain with proper details please. Compare the net production of ATP from four molecules of…

A: Glucose is a carbohydrate and it is degraded into carbon dioxide through glycolysis, pyruvate…

Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…

A: Phospholipids are found in the membrane. Their structure comprises of polar head group &…

Q: A) Discuss the significance of anomeric carbon in carbohydrates. B) Explain the differences between…

A: Anomeric carbons represent the carbon around which anomers rotate. This anomeric carbon is a…

Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…

A: Proteins or peptides are a linear chain of amino acids attached together via peptide bonds. Natural…

Q: Which of the following is the CORRECT relationship?

A: Phosphatidylinositol 4, 5 bisphosphate is known as PIP2 that is a component of cell membrane -…

Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À…

A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate…

Q: Calculate the standard free-energy change, deltaG°, for the reaction in which acetaldehyde is…

A: Standard free energy of biochemical reaction is related to standard reduction potential ∆Go = -nFEo…

Q: Which of the following contain a correct first statement and an incorrect second statement? O…

A: Polyols have have several hydroxyl (-OH )groups in their structure. Hydroxyl groups make the polyols…

Q: Which of the following enzymes is the key regulatory step in glycolysis? Phosphofructiokinase-1 is…

A: Glycolysis is a series of reactions that break down glucose into two three-carbon molecules known as…

Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…

A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…

Q: Match the following: choices: transcription factor

A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…

Q: Question 23 18:1cA9 O w-9 fatty acid O oleic acid

A: Polyunsaturated fats, such as omega-3 fatty acids, are a form of fat that body cannot produce.…

Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY

A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…

Q: explain serotonin dopamine and gaba and its effects.

A: Serotonin, dopamine and gaba all are the neurotransmitters means all are chemical massengers of…

Q: 2. Which of the following macro-molecule can be most structurally diverse among this living world?…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The 6C14 can be substituted for 6C12 in chemical reactions in a cell because it has: (It's not…

A: Carbon is an element abbreviated as C with atomic number 6. It belongs to the 14th group in the…

Q: What are the different types of RNA? Where are these types located within the cell?

A: Introduction: The structure of RNA is made up of a repeating strand of nucleotides that contain all…

Q: Give 5 examples of molybdenum complexes. State their physical and chemical properties and their…

A: The atomic number of molybdenum is 42 and it is represented by the symbol 'Mo'. On the earth,…

Q: Is there a possibility that our body is too much of amino acid? If there is, what are the…

A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group along with a…

Q: Identify the 4 steps of gluconeoegenesis that are different from glycoslysis. Write the reactants,…

A: Gluconeogenesis (GNG) is a metabolic pathway that results in the generation of glucose from certain…

Q: Explain the biochemical consequences of Glucose-6-Phosphatase deficiency that results in gout due to…

A: The enzyme glucose-6-phosphatase regulates the release of glucose from glycogen stored in the liver.…

Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…

A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…

Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1

A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide…

Q: State what is the likely magnitude of the Hill constant (nH) for HbA from your reading and state…

A: Hill equation is reflects the occupancy of biomolecule by respective ligands. i.e. fraction of…

Q: 8/9 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby or…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: The nucleic acids are known as polynucleotides. Monomeric units of nucleic acids are called…

Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest…

A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various…

Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino…

A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in…

Q: Answer choices are provided below for drop-down questions. 1. The overall charge of this protein at…

A: Since you have asked multiple questions and haven't specified which has to be answered. Therefore,…

Question

6. Using the concept of complementary base pairing, write the
complementary DNA strands, with their 5' and 3' ends labeled, for
each of the following DNA base sequences.
a. 5' AGCTAT 3' b. 5' TTACCG 3'
c. 3' GCATAA 5' d.
AACTGG

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction-

VIEW

Sequence of complimentary strands-

VIEW

Conclusion-

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds between deoxyribose molecules (b) ionic bonds between phosphate groups (c) covalent bonds between nucleotide bases (d) covalent bonds between deoxyribose molecules (e) hydrogen bonds between nucleotide bases
The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
What are the base-pairing rules for DNA? a. A-G, T-C b. A-C, T-G c. A-T, G-C
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
If a segment of DNA is 5 CATTAC 3, the complementary DNA strand is (a) 3 CATTAC 5 (b) 3 GTAATG 5 (c) 5 CATTAC 3 (d) 5 GTAATG 3 (e) 5 CATTAC 5
If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C? 27 percent 30 percent 23 percent 54 percent
#4 under Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases D. new complimentary strand of DNA
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. Explain the central dogma - how DNA, RNA, and proteins are related.