For gene expression profiling, what does a microarray or “gene chip” measure directly? Group of answer choices The amount of expressed proteins The number of copies of a gene The amount of transcribed mRNAs The rate at which cells divide
Q: A GWAS study using genomic resequencing may find a statistically significant SNP that is: (choose…
A: Introduction: A technical approach for associating specific genetic variation with a particular…
Q: Tỏ idéntify transcriptional regulatory elements, reporters containing 100 base pairs of Promoter…
A: Reporter genes help us to understand and determine the expression of gene of interest by fusing them…
Q: 1. List four general methods for experimentally inhibiting the activity of a specific gene with…
A: Gene inhibition is the regulation of gene expression in a cell that deactivates or silences or…
Q: Draw a basket mutant embryo. What does basket encode? Why do the mutant embryos have this phenotype?
A: A mutation is a change in the DNA sequence of an organism. Mutations can result from mistakes in DNA…
Q: Consider the microarray in Figure 20.12. If a sample from normal tissue is labeled with a green…
A: Introduction Gene are the key component of genetic material which control almost all the cellular…
Q: The goal of most gene therapies is to insert a healthy copy of a gene into the genome. Besides…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Which of the following statements about qPCR is true? a. The Ct value is generally directly…
A: qCR or Quantitative PCR is the technique which allows the measurement of expression levels by…
Q: Suppose you had isolated a new transcription factor and wanted to know which genes this protein…
A: Transcription is the process by which information contained in a strand of DNA is copied into a new…
Q: Northern blotting, RT-PCR, and microarrays can be used to analyze gene expression. A lab studies…
A: Gene expression is similar to protein expression and it is mediated by transcription and translation…
Q: If a fluorescent spot appears on a microarray, whatinformation does this provide regarding gene…
A: The genes are the hereditary unit of an organism. The DNA (deoxyribonucleic acid) is present in the…
Q: During experimental RNAi, how does the researcher affect expression of a target gene? Group of…
A: Introduction: In the process of RNA interference(RNAi) double-stranded RNA molecule suppresses the…
Q: What are the key findings of cancer genomics studies as they relate to chromatin biology?
A: Genomics is a branch of biology, which deals with studying and analyzing the structure, evolution,…
Q: B. Briefly describe how can RNA seq be used to quantify differential gene expression between two…
A: It is attainable by performing RNA-Seq with spike-ins, samples of ribonucleic acid at identified…
Q: Microarrays can be used to determine relative levels of gene expression. In one type of microarray,…
A: Antibiotic resistance causes growth of various strains of bacteria even after the addition of…
Q: If the expression microarray experiment was done with a normal sample and a suspected sample, after…
A: The application areas benefiting from such an approach include genomics and transcriptomics of…
Q: Researchers create a recombinant DNA molecule in which the coding sequence for GFP is inserted…
A: Recombinant DNA is the DNA that is formed by insertion of gene of interest into the original DNA.…
Q: Compare and contrast the use of histochemical reporter genes and fluorescent reporter genes — what…
A: Reporter genes can be analyzed by different methods, such as beta glucuronidase (uidA) gene…
Q: What factors do we consider in genetic transcription: precision, accuracy, or a combination of the…
A: Genetics is a branch of biology that deals with the study of genes and their role in inheritance. it…
Q: You want to clone a eukaryotic gene and express the protein in yeast. The protein typically…
A: Cells are divided into organelles which differ in their protein composition and cells must target…
Q: You are interested in finding out in which organ GTF2H5 is highly expressed experimentally. Describe…
A: Recombinant DNA also written as rDNA is formed by joining or combining the DNA from different…
Q: describe two blotting methods (i.e., Northern blottingand Western blotting) used to detect gene…
A: Northern blotting The northern blotting is a molecular biology technique used to study gene…
Q: ompare the different electrophoretic data band patterns in the zymogram provided. How would you…
A: Ans: Zymograph or zymogram: This is the electrophoretic technique that is used to detect the…
Q: The researcher above decides to test whether any gene functional classes or pathways are enriched…
A: INTRODUCTION Functional enrichment analysis, also known as pathway analysis, is quickly becoming one…
Q: Briefly describe the steps or methods for studying genes. Start with targeting a gene region and…
A: Gel electrophoresis is a strategy for investigating DNA dependent on its size (base-pair length). As…
Q: What can you say about relative gene expression for the gene of interest, normalized to that of the…
A: The correct answer for the problem will be that the relative gene expression for the gene of…
Q: Discuss the mechanisms by which transcription factors influence the reprogramming of somatic cells…
A: Somatic cells are similar to human beings in that they develop to fulfill a specific purpose in…
Q: What do microarrays tell you that studying gene expression byassaying individual enzymes cannot?
A: Introduction Gene are the key component of genetic material which control almost all the cellular…
Q: he steps to replicate the identified spike protein are as follows: . Find the CDNA sequence of the…
A: Gene expression is a phenomenon in which gene is expressed into a particular protein. It is a very…
Q: Where is the promoter ? 2 5. 6. Select an answer and submit. For keyboard navigation, use the…
A: Promoter is a region the DNA sequence where the transcription is initiated.
Q: How is RNA interference (RNAI) used as a form of gene therapy? O Small pieces of RNAI are used to…
A: There are few points about RNA interference: It is an evolutionary conserved mechanism of gene…
Q: Due to a nucleotide substitution, the fourth residue of H3 in a specific tissue cell of an organism…
A: Protein domains are the structural units of protein that are responsible for specific function of…
Q: What is the relationship between methylation and genomic imprinting? O Differential methylation of…
A: The DNA methylation is the process by which the gene expression is turned off. That means the…
Q: Identification and quantification of expressed genes initially requires a. reverse transcription of…
A: Gene is a basic unit of heredity and a sequence of nucleotides in DNA that encodes the Synthesis of…
Q: The switching of the components of the blood protein hemoglobin during embryonic and fetal…
A: Foetal haemoglobin is the oxygen carrier protein that transfers oxygen from mother's blood stream to…
Q: DNA markers have greatly enhanced the mapping of genes in humans. What are DNA markers, and what…
A: The chemical substance that is passed from the preceding generation to the succeeding generation is…
Q: which laboratory method can be used to quantify levels of mRNAs expressed in samples of two…
A: Biological approaches are a well-developed field in process technology for treating a wide range of…
Q: Can you explain a brief description of each of the methods used?
A: The experiment was performed for rearranging the genes of the yeast strain and further study was…
Q: What does it mean for a transposable element to be effectively “dead”? A. The transposable elements…
A: A transposable element is a DNA sequence that can change its position within a genome
Q: elect molecular outcomes that can be achieved with the CRISPR-Cas9 system (Check all that apply.)…
A: CRISPR- Cas9 is a genome-editing tool which is derived from bacteria.
Q: In a microarray experiment, if you label cDNA from Tissue #1 with a red color and cDNA from tissue…
A: Microarray is the laboratory tool which is used to detect the expression levels of hundreds of genes…
Q: When performing QPCR to study differential gene expression, what is the role of SYBR green? What is…
A: Introduction :- SYBR Green is a cyanine dye used in molecular biology studies as a nucleic acid…
Q: Genome-wide RNAi screens target expression of > 16,000 genes. Explain how each of these 16,000+…
A: The control of gene expression in a cell to inhibit the expression of a specific gene is known as…
Q: Protein expression: Given that we control the composition of the medium in which we grow our…
A: Genetic engineering is the branch of biological sciences which deals with making manipulation in the…
Q: Suppose that you have just graduated from college and have started working at a biotechnology firm.…
A: Prolactin is a proteinaceous hormone that is produced by our pituitary gland that helps in the…
Q: 6 of 16 Which gene would most likely be under inducible expression control?
A: There are two types of expression systems of genes they are constitutive expression system and…
Q: the method and experiments where Simplifying Protein Expression with myTXTL is used
A: This is a very easy technique used for protein synthesis. The major advantage is that it is a cell…
Q: What is the benefit of a gene “knockout”? MARK ALL THAT APPLY. Group of answer choices It allows…
A: Gene knockout is the manipulation of organisms DNA leading to the permanent change and its loss of…
Q: What gene expression question could you answer using data from the ENCODE website
A: Gene expression includes the synthesis of an RNA transcript from a DNA template and translation of…
Q: We looked at RNA-mediated mechanisms of gene regulation in both eukaryotes and prokaryotes. a.…
A: All eukaryotic prokaryotes are homologous to one another and to prokartoyotic RNA polymerase. in…
Q: Why are some genes expressed and some not? Please be as detailed as possible.
A: Genes are a set of nucleotides sequence that carries information to be passed on from one generation…
49.
For gene expression profiling, what does a microarray or “gene chip” measure directly?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/RNAi is a method to assess........ gene expression gene sequence gene function Chromosomal location of a gene
- Read the article to understand how gene expression is controlled. https://sphweb.bumc.bu.edu/otlt/MPH-Modules/PH/DNA-Genetics/DNA-Genetics7.html (Links to an external site.) As your output for this lesson, compare how histones and micro RNA control gene expression.What means of informative molecules in genetic tearm.Identical twin brothers begin life with identical genomes andepigenomes. How will this circumstance change with age?Suggest how these changes could be used as a forensic tool.
- The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)35) A researcher inserted DNA fragments from an organism into expression vector plasmids and introduced the modified plasmids into bacterial cells. Which of the following methods would be an effective means of identifying which clones contain a specific gene of interest?The ability to make modifications in the genomeprovides unlimited possibilities. With this, some groups raise publicconcerns about the possible negative effects of the widespread use andmanufacture of GM products. This makes genetic engineering a verycontroversial topic regarding its ethics. Write a 10 sentences reflection onthe pros and cons of genetic engineering, on a separate sheet of paper.
- . The website CBioPortal (http://www.cbioportal.org)is an exceptionally useful program for visualizing thecancer genes and genomes of tumors from thousandsof patients with different kinds of cancer that havebeen analyzed by whole genome sequencing and insome cases, by RNA-Seq.Go the the CBioPortal site and click All underSelect Cancer Study and in Enter Gene Set typePTEN, then hit Submit. On the page that is returnedyou will see how the coding region of the PTEN geneis altered in tumors investigated in the various studies.Hitting the tab Mutations will let you see the detailsof these mutations relative to the PTEN protein, whilethe tab Expression lets you see how the gene’s expression (in terms of cDNA reads) is altered in individual tumor samples.a. Is PTEN an oncogene or a tumor suppressor gene?What kinds of evidence lead you to this conclusion?b. What kinds of cancer are most likely to involvealterations of PTEN?c. How would you identify patients whose tumorcells are particularly…Relative to this image of the steps in gene cloning, identify the steps involved and the protein/enzyme requirements of each.9) Describe the steps required to use sequencing DNA to identify your gene of interest after performing a forward genetic screen.
