a. If you forgot to add dNTPs to a sequencing reaction, what would be the result? Only very long fragments would be synthesized Only very short fragments would be synthesized The fragments would not be labelled DNA polymerase would be inactivated Sequencing would proceed normallyb. Please also answer the image You are performing a PCR as diagrammed below (green arrows indicate primer binding sites). However, your DNA sequence contains an insertion (additional sequence) shown in red. What effect will this have on the PCR product produced?5'3'3'5'The PCR product will be larger than without the insertion.The PCR product will be smaller than without the insertion.The PCR product will be the same size regardless of the presence of the insertion.The PCR reaction won't work in the presence of the insertion.

Introduction :- DNA polymerase is an enzyme which shows 5' - 3' polymerase activity , because it…

. If you forgot to add dNTPs to a sequencing reaction, what would be the result? Only very long fragments would be synthesized Only very short fragments would be synthesized The fragments would not be labelled DNA polymerase would be inactivated Sequencing would proceed normally

. If you forgot to add dNTPs to a sequencing reaction, what would be the result? Only very long fragments would be synthesized Only very short fragments would be synthesized The fragments would not be labelled DNA polymerase would be inactivated Sequencing would proceed normally

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Related questions

Q: You have extracted a long piece of DNA from a human cell and you want to extract the gene of…

A: Genes are a series of instructions that govern how an organism looks, how it survives, and how it…

Q: A) If one of the primers has a point mutation distinct from the template what is the percentage of…

A: PCR or polymerase chain reaction is a technique which is used in amplification of DNA or produce…

Q: A circular DNA of 40 kb (40,000 bases) length is cut with a restriction enzyme whose precise…

A: The probability of a restriction enzyme to be found in a DNA is 4n, where n is the number of bases…

Q: Your company has decided to develop a PCR test that will be used to determine Huntington's disease.…

A: The polymerase chain reaction (PCR), is one of the most useful molecular biology techniques used to…

Q: Which of the following ingredients does not belong in a sequencing reaction? (A ddNTPs B Primer C…

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…

A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…

Q: You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an…

A: The term DNA cloning is associated with a process that plays an important role in making copies of a…

Q: 1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the…

A: A laboratory technique for amplifying DNA sequences is polymerase chain reaction (PCR). The approach…

Q: Advantages of using the PCR include the following EXCEPT A it will always give the desired product…

A: Introduction PCR:- It is a technique to make many copies of a specific DNA region in vitro, It…

Q: Briefly explain the rationales of adding Bisacridine A which can affect DNA stability in polymerase…

A: PCR is used to enhance genes associated with patients' DNA genetic disorders. It has practical uses…

Q: Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts…

A: DNA helicase is used during the DNA replication process where it binds to the double-stranded DNA…

Q: a) Explain the effect of the guanine:cytosine ratio on melting temperature of DNA. b) The…

A: (a) Guanine : cytosine ratio is the ratio of base pairs in the DNA. There are four bases in DNA -…

Q: If the primer that you design anneals to two different regions of the DNA to be sequenced, the…

A: A primer is a short sequence of nucleic acids that serves as a starting point for DNA synthesis.…

Q: You are preparing to amplify a DNA sample using PCR and add the following to your set-up: forward…

A: PCR or polymers chain reaction is a process that use to amplify a particular DNA. It needs different…

Q: SNP-chips are used ____. a. with short tandem repeat profiling b. to sequence DNA. c. in…

A: SNP array is very useful tool for study of slight variations between whole genomes.The most…

Q: During proofreading, which of the following enzymes reads the DNA? a. primase b. topoisomerase c.…

A: BASIC INFORMATION DNA it stands for deoxyribo nucleic acid. it is the genetic material of all…

Q: Which of the folllowing is the term used for ultra compact form of DNA coiling? a. supercoiling…

A: Compacting DNA is important for packaging it within the cells. As the length of a DNA molecule can…

Q: Amplified target regions of four different samples were separated using gel electrophoresis. DNA…

A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…

Q: A gel pattern displaying PCR products shows four strong bands. The four pieces of DNA have lengths…

A: The polymerase chain reaction is a molecular biological technique responsible for exponentially…

Q: Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to…

A: Answer: REPLICATION of DNA : It is the process in molecular biology where DNA strands are used to…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: In the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging…

A: The fragments of DNA synthesized by DNA polymerases during lagging strand synthesis are described as…

Q: Briefly explain the rationales of adding chemicals that can affect DNA stability in a polymerase…

A: Ans: Polymerase Chain Reaction (PCR): The in-vitro amplification of DNA by using primers, dNTPs, taq…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…

A: DNA Polymerase is the main enzyme of replication. It adds deoxyribonucleotides according to the…

Q: You performed RADseq analysis of two genomes using the restriction enzyme EcoRI. From each genome,…

A: * Restriction site associated DNA (RAD) markers are genetic marker that are used for association…

Q: You are trying to study the effects of Drug A on the expression of Gene X in a tumor sample (lane…

A: Reverse transcription enzyme chain reaction (RT-PCR) may be a variation of normal PCR that involves…

Q: When we discuss PCR and other similar techniques, the term Tm is often used. This refers to a.The…

A: PCR ( Polymerase Chain Reaction) is a technique in which numerous copies of genetic material (…

Q: The figure below shows the recognition sequences and cleavage positions of three restriction…

A: Restriction enzymes are those that have a tendnecy to cut the strands of DNA straight. This leads to…

Q: The typical cycle of a PCR reaction includes a period of time at 95 degrees, 55 degrees, and 72…

A: PCR which is also called as Polymerase Chain Reaction is a method used in DNA amplification of…

Q: The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction.…

A: Sanger sequencing (also known as chain termination sequencing) is a DNA sequencing technology that…

Q: ARE THEY TRUE OR FALSE? a) In a caesium chloride density gradient centrifugation method performed…

A: DNA is the genetic material that helps to control all the activity of the cell. The replication,…

Q: Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in…

A: The polymeric chain reaction (PCR) is a technique in which amplification of a specific DNA segment…

Q: What is the reason that the Taq polymerase is currently used? A the Taq polymerase is one of the…

A: Taq polymerase is obtained from a thermophilic (those organisms which can survive in very high…

Q: indicate which of the following statements is/are FALSE for qPCR A. The sequence order of steps…

A: qPCR Quantitative Polymerase Chain Reaction (qPCR) also known as Real-Time Polymerase Chain Reaction…

Q: Which of the following statements about DNA probes are false? a. Probes can be labeled with a…

A: In the biotechnology special in recombinant DNA technology the probe is very much important and it…

Q: Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The…

A: Primers are short sequences of single stranded polymer that mark each ends of the target sequence. 2…

Q: Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the…

A: PCR, or the polymerase chain reaction, is a technique used by molecular biologists to amplify…

Q: Please answer both parts, a. The enzyme that catalyzes the joining of fragments to form recombinant…

A: The recombinant DNA technology is a branch of biology that deals with different techniques that…

Q: Restriction enzymes cut double-stranded DNA _____. a. at noncoding areas between genes b.…

A: Restriction enzymes cut double-stranded only at specific sequence of the dna, producing either a…

Q: You are trying to clone a gene. You have successfully isolated it from the genomic DNA of an…

A: Gene cloning is a process to form multiple copies of desired DNA of interest. This is done to- * to…

Q: A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: Restriction enzymes are essential tools in genetic engineering. Discuss with diagrams

A: As per our guidelines, we are supposed to answer only one question. Kindly repost the other question…

Q: Find out whether the following are true or false. a)Klenow polymerase is E. coli DNA polymerase I…

A: Polymerase chain reaction involes denaturation, annealing and extension steps at varied temperature…

Q: A cloned fragment of DNA was sequenced by using thedideoxy chain-termination method. A part of the…

A: The process is usually defined as the way that they are been determining the sequence of nucleotides…

Q: PCR

A: Polymerase chain reaction is known as PCR. PCR is a technique which is used to amplify or copy the…

Question

a. If you forgot to add dNTPs to a sequencing reaction, what would be the result? Only very long fragments would be synthesized Only very short fragments would be synthesized The fragments would not be labelled DNA polymerase would be inactivated Sequencing would proceed normally b. Please also answer the image

You are performing a PCR as diagrammed below (green arrows indicate primer binding sites). However, your DNA sequence contains an insertion (additional sequence) shown in red. What effect will this have on the PCR product produced?
5'
3'
3'
5'
The PCR product will be larger than without the insertion.
The PCR product will be smaller than without the insertion.
The PCR product will be the same size regardless of the presence of the insertion.
The PCR reaction won't work in the presence of the insertion.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.
Look at each PCR component listed below. For each one, determine which steps(s) of the PCR reaction (denaturation, annealing or extension) would be directly affect if that component were missing. Taq polymerase: Oligonucleotide primers: DNA template: Deoxynucleotides (A, T, G and C): Imagine that you correctly prepare your PCR reaction mixture, but there is something wrong with the thermal cycler. Describe what would happen if: The thermal cycler was stuck on 940C: The thermal cycler cycled between 600C and 720C, but never reached 940C The thermal cycler cycled between 940C and 720C, but never reached 600
Put the steps of one PCR cycle in the correct order: The PCR reaction mixture is heated to about 70 degrees, which is the optimum temperature for the polymerase to build the new strands of DNA, starting at the 3' end of the primer. The PCR reaction mixture is heated to 95 degrees Celsius, which denatures the double stranded template DNA. The PCR reaction mixture is cooled to about 50-55 degrees, which allows the primers to find their complementary site on the template and "anneal" the
Imagine that you are producing a PCR product of approximately 2.1 kb in size with constant non-specific products which are two very light bands present above the desired product and another intense band below the desired product. Now for an experiment, you need very pure products out of the PCR process. To avoid non-specific product production, you want to take a different PCR approach. There are two PCR processes that your supervisor has recommended you which are: Touchdown PCR technique and Gradient PCR technique. Considering that you need the pure product only once for your future experiment, mention in no more than 5 sentences which PCR technique will you choose and why?
Which of the following is necessary for a PCR reaction to proceed? a) the sequence of the ends of the DNA to be amplified must be known. b) the sequence of restriction endonuclease recognition sites in the DNA to be amplified and in the plasmid, where the amplified DNA fragment will be cloned must be known. c) The complete sequence of the DNA to be amplified must be known. d) The sequence of restriction endonuclease recognition sites in the DNA to be amplified must be known
A student carries out PCR using the following steps: step 1: 94C for 1 minuteStep 2: 60C for 30seconds Step 3: 72C for 30 seconds The student is examining a 1000-bp DNA fragment as part of their research project. If the limit of detection of this molecule 9 x 108 molecules, what is the minimum number of PCR cycles you would have to run to detect PCR product generated from a single molecule of the template? 2. Two double-stranded fragments of DNA are exactly the same length. At 89 C, fragment A has completely denatured which means the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ to result in different denaturation temperatures?
You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.
A student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR. The DNA template is at a concentration of 65.0 ng µL-1, and the student determines that a serial dilution is required because directly adding the DNA template would require a volume less than 1.00 µL. The student wants to prepare an intermediate solution at a concentration of 15.0 ng µL-1. If the DNA template stock will be mixed with 13.0 µL of ultrapure H2O, calculate the volume (in µL) of the DNA template required to prepare the intermediate solution.
Ben used the following primer pairs to amplify the COI region of his DNA template: Afterwards, he used Agarose Gel Electrophoresis to visualize the PCR products. Based on the gel: a) Was he able to successfully amplify the desired region in all replicates? b) Are there errors in Ben's gel? Does he need to repeat his PCR?
The answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)
Why is it important to sequence positive clones derived from PCR cloning? Group of answer choices Errors could have been incorporated during restriction enzyme digestion and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during plasmid DNA extraction and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during PCR and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during cloning and so it is important to verify that only the expected protein is produced.
.How much PCR product (500 bp) should be added to a ligation in which 50 ng of Vector (6.6 kb) vector will be used if a 3:1 insert:vector molar ratio is desired? Vector concentration is 50 ng/uL and insert concentration is 35 ng/ul. Provide mass and volumes for the ligation reaction