From the list below, which would be true if you expressed a eukaryotic gene in a bacterial cell? The transcript in bacteria would not contain a poly A tail The transcript in bacteria would not contain a 5’ methyl cap The transcript in bacteria would contain introns The transcript in bacteria would contain A, G, C and U nucleotides All of the above

From the list below, which would be true if you expressed a eukaryotic gene in a bacterial cell? The transcript in bacteria would not contain a poly A tail The transcript in bacteria would not contain a 5’ methyl cap The transcript in bacteria would contain introns The transcript in bacteria would contain A, G, C and U nucleotides All of the above

Name: From the list below, which would be true if you expressed a eukaryotic
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: From the list below, which would be true if you expressed a eukaryotic gene in a bacterial cell?The transcript in bacteria would not contain a poly A tailThe transcript in bacteria would not contain a 5’ methyl capThe transcript in bacteria would con

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which of the following statements about the attempt to express a eukaryotic gene in bacteria is TRUE? Choose an answer below: The eukaryotic promoter will function in the bacterial cells. The transcript will be capped. Expression of the gene will always yield a functional protein. The stop codon of the eukaryotic gene will function in the bacterial cells. The transcript will be spliced the same way as in eukaryotic cells.
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA transcript that would be made in this region? Group of answer choices 5' AUGCGCUAGCUG 3' 5' CAGUAGCGCAU 3' 5' UACGCGAUCGAC 3' 5' CAGCTAGCGCAT 3' 5' ATGCGCTAGCTG 3'
radioactively labeled cDNA is used to probe RNA isolated from kidney by Northern blotting. Twobands are seen on the blot. Which of the following reasons is least possible? A. A single pre mRNA is spliced into two different messagesB. There are two promoters for the geneC. There are two related genes expressed in kidneyD. The mRNA is cleaved in the cytoplasm as part of its degradation Explain why the answer is B or EE. There is a single mRNA produced but some is not polyadenylated
One of the following best describes the cap modification of eukaryotic mRNAa) Modified guanine nucleotide added to the 3’ end of the transcriptb) Modified guanine nucleotide added to the 5’ end of the transcriptc) String of adenine nucleotides added to the 3’ end of the transcriptd) String of adenine nucleotides added to the 5’ end of the transcript
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1. Protects transcript from enzymatic degradation 2. Polyadenylation signal 3.Accepts the incoming charged tRNA 4.Upstream sequence region to which transcription factors and RNA polymerase are recruited. 5.Complementary to tRNA carrying methionine 6.segment of transcript that codes for protein
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH modifications, or NEITHER modification. Briefly (1 sentence) support your answer. Promotes translation of the mRNA at the 3' end. Acts to prevent degradation of the mRNA by exonucleases. Promotes splicing of the mRNA. Promotes binding of transcription factors to the Mediator complex.
What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription instead of translation Peptide bond formation is inhibited Incoming tRNA will not be able to enter through the A site Incoming tRNA will not be able to enter through the P site Incoming tRNA will not be able to enter through the E site Translocation is inhibited Hairpin loop formation
The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold). a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)