Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will be transcribed? Or which regions will be part of the new RNA molecule that is synthesized during transcription? Select all that apply. Promoter Intron Exon Transcription stop site Transcription start site ATG 75 TAC TAA ATT 3' 5' 3' 50 100 300 200 228 50 3' 5' Start Splice donor codon Splice acceptor Splice аcсеptor Splice donor Stop codon Exons Ribosomal binding site Promoter Introns

Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will be transcribed? Or which regions will be part of the new RNA molecule that is synthesized during transcription? Select all that apply. Promoter Intron Exon Transcription stop site Transcription start site ATG 75 TAC TAA ATT 3' 5' 3' 50 100 300 200 228 50 3' 5' Start Splice donor codon Splice acceptor Splice аcсеptor Splice donor Stop codon Exons Ribosomal binding site Promoter Introns

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT 1.The mutation would move the promoter away from consensus and reduce the level of transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would bind the promoter to the consensus and produce normal levels of transcription 4.The mutation would inhibit the promoter thereby inhibiting transcription
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
82Transcription termination takes place downstream from the _______________. A.poly(A) siteb.promoter regionc.5'-m7 G capsD.enhancer sequences 83The core promoter element of RNA polymerase II extends from about 40 bp upstream of the transcription initiation site to about _______ bp downstream from this site. A.100b.1000c.40D.200 84Archaeal and eukaryotic ribosome structure appear to be different from the bacterial ribosome structure. Yesorno
Consider Figure 3, which shows some features of a eukaryotic gene. A, B, C are exons while 1, 2 are introns. E marks an enhancer. The 5’ UTR and 3’ UTR are also marked. Which one of the following features would you expect to NOT be included in the primary RNA (before any processing has occurred) that results from transcription of this gene? Region marked E Region marked 5’ UTR Regions marked A, B and C Regions marked 1 and 2
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.