Gene Expression VAVAVAVAAVAVAVAY Transcription Translation RNA polymerase 5' 3' 3' 5' DNA -MRNA strand -Ribosome Promoter Terminator 5' -Polypeptide Direction of ribosome movement Ribosome- Start binding site codon O FIGURE 7.16 In Prokaryotes, Translation Begins as the mRNA Molecule Is Still Being Synthesized Ribosomes begin translating the 5' end of MRNA before transcription is complete. More than one ribosome can be translating the same mRNA molecule.

Gene Expression VAVAVAVAAVAVAVAY Transcription Translation RNA polymerase 5' 3' 3' 5' DNA -MRNA strand -Ribosome Promoter Terminator 5' -Polypeptide Direction of ribosome movement Ribosome- Start binding site codon O FIGURE 7.16 In Prokaryotes, Translation Begins as the mRNA Molecule Is Still Being Synthesized Ribosomes begin translating the 5' end of MRNA before transcription is complete. More than one ribosome can be translating the same mRNA molecule.

Name: Why is the position of the first AUG after the ribosome-binding site c
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Why is the position of the first AUG after the ribosome-binding site critical? Gene ExpressionVAVAVAVAAVAVAVAYTranscriptionTranslationRNA polymerase5'3'3'5'DNA-MRNA strand-RibosomePromoterTerminator5'-PolypeptideDirection ofribosomemovementRibosome-

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNA
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 8
Bacteria or Eukaryotes? Formation of a termination loop within the transcript Alternative splicing of transcripts Translation beginning before transcription is complete Cleavage following the AAUAAA signal Direct binding of RNA polymerase to promoter
T The template strand of a gene contains the sequence 3’- TTCAGTCGT-5’. Imagine that the nontemplate sequence was transcribed instead of the template sequence. Draw the mRNA sequence and translate it using Figure 17.6. (Be sure to pay attention to the 5’ and 3’ ends.) Predict how well the protein synthesized from the nontemplate strand would function, if at all.
mRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein
Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain: