Part AWhich of the following processes is represented in the figure below?A5'ÀÚGÚÚČĞĞŮ3'AAG UGAUUCRF1RF2transcription initiationtranslation initiationtranslation elongationtranscription elongationtranslation terminationO O O

Name: Part AWhich of the following processes is represented in the figure b
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Part AWhich of the following processes is represented in the figure below?A5'ÀÚGÚÚČĞĞŮ3'AAG UGAUUCRF1RF2transcription initiationtranslation initiationtranslation elongationtranscription elongationtranslation terminationO O O

Thank you for the question Answer :- The given picture shows translation termination Explanation :-…

Science

Biology

Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O transcription initiation O translation initiation O translation elongation O transcription elongation O translation termination

Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O transcription initiation O translation initiation O translation elongation O transcription elongation O translation termination

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Ser
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G b.EF-Ts c.EF-Tu d.EF-P
Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.