Fill in the blanks Translation starts at thecodon. The TRNA brings in the correctto the ribosome, matching theon the mRNA. As the amino acids are brought in,bonds between them forming a polypeptide until theycodon where translation stops and everything is released.on theTRNA to thethey formreach acode. This code is the sameCodons code for specific amino acids which creates thefor all organisms on earth.If given a DNA sequence of ACGTCGAAC, the mRNA sequence would bewould result in the amino acid sequence ofThisLys AseArg.ProArgCAGHeHisThrC AGinU GSerA C

Note: Please Cross Check The Last Fill In The Blanks, Due To Half Image I wasn't Able to figure out…

Translation starts at the codon. The TRNA brings in the correct to the ribosome, matching the on the mRNA. As the amino acids are brought in, on the TRNA to the they form reach a bonds between them forming a polypeptide until they codon where translation stops and everything is released. code. This code is the same Codons code for specific amino acids which creates the for all organisms on earth. If given a DNA sequence of ACGTCGAAC, the mRNA sequence would be would result in the amino acid sequence of This Pro Arg Arg CAG He His Thr C A Gin U G Set A C

Translation starts at the codon. The TRNA brings in the correct to the ribosome, matching the on the mRNA. As the amino acids are brought in, on the TRNA to the they form reach a bonds between them forming a polypeptide until they codon where translation stops and everything is released. code. This code is the same Codons code for specific amino acids which creates the for all organisms on earth. If given a DNA sequence of ACGTCGAAC, the mRNA sequence would be would result in the amino acid sequence of This Pro Arg Arg CAG He His Thr C A Gin U G Set A C

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

A. rRNA is used to transfer amino acids to the ribosome. make up the large ribosomal subunit. make up the subunits of a ribosome. make up the small ribosomal subunit. B. When the full ribosome has bound to mRNA for the first time, the first codon (start codon) of the mRNA is in which site? It varies. P E A
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper discribtion what is happening in translation? In my texxbook it is explaing that mrna goesto rrna and rrna is the maker of the amino... or am I misunderstanding?
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
Match the type of RNA with it's function A. Creates the Ribosome, or work table to pull amino acids together? [ Choose ] rRNA mRNA tRNA B.Carries or "Transfers" amino acids from the cytoplasm to the ribosome [ Choose ] rRNA mRNA tRNA C. Is the copy of DNA from the nucleus, therefore bringing the "message" concerning what protein to build [ Choose ] rRNA mRNA tRNA
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that comprises the transfer RNA b) mRNA transcript just after transcription c) polypeptide chain released by ribosome d) mRNA transcript that a ribosome attaches to
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids
An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a stop codon.
From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.
Process of translation *( Choose True if the statement is correct abourt genetic code and False if otherwise ) includes covalent modification of some proteins participation of rRNA transfer RNA is made from messenger RNA tRNA uses information from mRNA to produce amino acid chains