DNA ONA 200000 700000 -MRNA Polypeptide- Chain Polypeptide- Chain Ribosome MRNA Ribosome Student 1 Student 2 which student created the model that is the most accurate representation of how information in genes is expressed as prote

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…

A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…

Q: 21a. Fill in the blanks to label each type of molecule in this figure. asp a.TRNA b.amino acids leu…

A: The synthesis of proteins takes two steps: transcription and translation. Transcription takes the…

Q: The Central Dogma Protein information cannot flow DNA Transcription back to nucleic acids RNA •…

A: The 'Central Dogma' is the process by which the instructions in the DNA are converted into a…

Q: spings gating its gen ISlation from this organism and use it to translate (in a test tube) some RNA…

A: The nucleotide in a DNA is a group which is arranged in a linear sequence in a DNA which contains…

Q: In which direction is RNA synthesized: 5' to 3' or 3' to 5' ?

A: RNA is synthesized always from 5'-3'.

Q: twenty two Walter Gilbert coined the term ( ) for a sequence that appears in a mature RNA.…

A: 23) The ______________ pathway blocks mRNA translation or causes mRNA degradation. Ans) miRNA miRNA…

Q: elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit…

A: Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…

Q: Write all the possible mRNA sequences that can code for a simple tripeptide segment Leu-Trp-Glu.…

A: Translation is the process of conversion of mRNA to protein . In this , Each codon is basically a…

Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…

A: There are different types of mutations, that result in a change or no change in the protein…

Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA 1.…

A: Information coded in the DNA is transcribed in the form of mRNA, these mRNA then translate this…

Q: Polysomes and Rapid _______ Recycling Increase the Efficiency of Translation.

A: Ans: Translation: The process of joining amino acids together with the help of mRNA, tRNA and…

Q: Let’s practice making a strand of mRNA. Finish what we started: DNA:…

A: Messenger RNA  is a single-stranded RNA molecule that is complementary to the DNA strand of a gene.

Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…

A: Inside the nucleus of the cell , DNA act as a  template for the manufacturing of single strand of…

Q: An RNA sequence includes 15 bases. How many amino acids does this sequence encode? 3 0 5 O 15 O 45

A: RNA is a molecule that consists of a single strand of nucleotides. It is a product of transcription…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: T The template strand of a gene contains the sequence 3’- TTCAGTCGT-5’. Imagine that the nontemplate…

A: The process of translation involves protein synthesis from messenger RNA (mRNA).Ribosomes translate…

Q: 91 The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yes or…

A: Transcription is the process of RNA synthesis from the DNA template. It occurs within the nucleus of…

Q: AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for…

A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…

Q: True or false Both pentose nucleic acid and deoxypentose nucleic acid contain the same pyrimidines…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve first three…

Q: Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed…

A: The peptide bond is also similar to an amide bond that helps to join two amino acids and make a…

Q: A tRNA that has the anticodon GAG carries which amino acid?

A: tRNA is a special kind of RNA molecule. It is also called transfer RNA. tRNA or transfer RNA is…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA | 1.…

A: Transcription is process of formation of mRNA from DNA template by addition of complementary…

Q: Molecule Structure, Function diagram or description TRNA Ribosome MRNA poly-a tail

A: Transcription is the process of synthesis of RNA from DNA, using DNA as a template. It is initiated…

Q: Transcription Translation DNA MRNA Protein The central dogma of molecular biology states that…

A: Central dogma of Molecular Biology states that information runs unidirectionally from DNA to RNA…

Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: START CODON STOP CODON 3' MRNA 5' UGAUCAU GAUCUCGUAAGAUAUC Met Ile Ser) STOP Polypeptide 1. Why do…

A: DNA is the genetic material that is present in almost all the organisms except for the viruses that…

Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Describe the structure of a polysome, which is depicted.

A: Ribonucleic acid (RNA) is a genetic material that plays a vital role in ribosome and protein…

Q: question #3

A: Ribosomes are known as protein factories of the cell. They are of two types- 1. Prokaryotic…

Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…

A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…

Q: TRANSCRIPTION a) polypeptide TRANSLATION a) MRNA b) both strands of DNA c) TRNA d) one strand of DNA…

A: For replication, we require both strand of DNA that will act as template stand for bi-directional…

Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…

A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…

Q: A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table  and give…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Anticodon Anticodon Anticodon 3 1 5'-IAG-3' 5'-UAU-3' 5'-AAA-3' codon MRNA 5'- -3' 5' _3' 3' 5' 3. 1…

A: Multiple subparts are there in question. I will answer first 3 subparts, as per guidelines. In RNA,…

Q: BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in…

A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…

Q: Pre-MRNA 5' Cap Poly Codon numbers 105- 146 1-30 31-104 Introns cut out and exons spliced together…

A: The central dogma is a process that includes transcription (production of RNA from DNA) and…

Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…

A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA 1.…

A: The 'Central Dogma' is the process which defines that the instructions in DNA are converted into a…

Q: Table 9-2 Transcription of Oxytocin DNA Triplets ACG ATG TAT GTT TTG ACG GGA GAC C mRNA ACA AUC AUA…

A: A mRNA codon constitutes a group of three nucleotide bases. Each codon codes for a particular amino…

Q: The genetic code is Random in that the codons for the same amino acid are structurally unrelated…

A: Genetic code contains information that can be used by certain organelles to translate information…

Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…

A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…

Q: 40.The mRNA codon for methionine is the start codon in eukarvotes. What is the corresponding three…

A: The start codon is the sequence of three nucleotides present on mRNA that is responsible for the…

Q: Translation a. In the diagram above, draw a rectangle around the part that represents translation.…

A: Need to answer the questions related to translation process.  Need to determine the step by step…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: To find: To find the complementary base sequence and the corresponding mRNA sequence using the given…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.