Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the codon models on the left with the codon sequence(s) that scientists originally thought might be read from this mRNA. Four-base codon, not overlapping. Three-base codon, not overlapping. Two-base codon, overlapping. Two-base codon, not overlapping. Three-base codon, overlapping. 5'... GU GU GU GU GU... 3' or 5'... UG UG UG UG UG...3′ 5'... GU UG GU UG GU UG GU UG...3′ 5'... GUG UGU GUG U etc. . . . 3' 5'... GUG UGU GUG UGU GUG etc....3' 5'... GUGU GUGU GUGU... 3' or 5'... UGUG UGUG UGUG... 3'

Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the codon models on the left with the codon sequence(s) that scientists originally thought might be read from this mRNA. Four-base codon, not overlapping. Three-base codon, not overlapping. Two-base codon, overlapping. Two-base codon, not overlapping. Three-base codon, overlapping. 5'... GU GU GU GU GU... 3' or 5'... UG UG UG UG UG...3′ 5'... GU UG GU UG GU UG GU UG...3′ 5'... GUG UGU GUG U etc. . . . 3' 5'... GUG UGU GUG UGU GUG etc....3' 5'... GUGU GUGU GUGU... 3' or 5'... UGUG UGUG UGUG... 3'

Name: Give typing answer with explanation and conclusion Given an artificial
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the codon models on the leftwith the codon sequence(s) that scientists originally thought might be read

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
UAA is a stop codon. Why does the UAA sequence in the segment of mRNA 5′-G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U-U-A-A-A-C-A-C-3′not cause protein synthesis to stop?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?
3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?
An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..
During the termination of translation, what is the correct polypeptide sequence which will be released by the ribosome? 5' - AUG - UAU - CUC - UUU - 3' (mRNA codon sequence) 3' - UAC - AUA - GAG - AAA - 5' (tRNA anticodon sequence) A.START - Tyr - Leu - Phe B. Tyr - Ile - Glu - Lys C. START - Ile - Glu - Lys D. Ser - Tyr - Gly - Cys
You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several different synthetic repeating mRNAs in translation reactions and analyze the sequences of the polypeptides produced from each reaction. The results are summarized below. mRNA sequence used: ...CACACACACACACAC... Polypeptide produced: ...His-Thr-His-Thr-His-Thr ...mRNA sequence used: ...CCACCACCACCACCA...Polypeptide produced: ...Thr-Thr-Thr... and ...Pro-Pro-Pro... and ...His-His-His...mRNA sequence used: ...ACAACAACAACAACA...Polypeptide produced: ...Thr-Thr-Thr... and ...Asn-Asn-Asn... and ...Gln-Gln-Gln... Based on these results, write what amino acid each codon below corresponds to. If there is not enough information to narrow down to one amino acid, write all the possibilities.CAC: ___________________________ ACC: ___________________________ ACA: ___________________________ CAA: ___________________________ CCA: ___________________________ AAC: ___________________________