I do not know how to do this problem. Given the following strand of DNA, find:1. the complementary DNA strand2. the MRNA3. the TRNA4. the amino acids.3'-ТАС АСС TTT CAА АСТ -5'***Be sure to number the parts of your answer #1-4.***Include 5' and 3' where applicable.AlanineAGUAGUTyrosineStopValineCysteineG TryptophanArginineC.ACULeucineSerine uCUGGACULysineAProlineAsparagineGACU GACUDNA 2.0Glycinehenyl-alanineGlutamicacidAspartic acidUGHistidineGlutamineO ArginineIsoleucineThreonineMethionine

Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Answered: Given the following strand of DNA,…

Given the following strand of DNA, find: 1. the complementary DNA strand 2. the mRNA 3. the TRNA 4. the amino acids. 3'- TAC ACC TTT CAA ACT -5'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Related questions

Q: Which of the following statements about DNA is true? (Select all that applied) Select one: O a. DNA…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: A key difference between the nucleotides found in DNA andthose in RNA is thata. DNA has phosphate,…

A: Deoxy ribonucleic acid (DNA) is he genetioc material of most organisms, while ribonucleic acid (RNA)…

Q: Which of the following is not a DNA sequence? a. TAG b. AUGAUUCT d. AAAAAAAAAA e. CGG

A: DNA is also called deoxyribonucleic acid. DNA acts as genetic material for almost every organism…

Q: A sample of DNA contains 40% adenine-thymine base pairs altogether. What percentage of the DNA will…

A: Q. A sample of DNA contains 40% adenine-thymine base pairs altogether. What percentage of the DNA…

Q: A double stranded DNA fragment contains 12% adenine residues. What is the percentage of cytosine…

A: According to Chargraff's law, the number of purines equals the number of pyrimidines. Purines are…

Q: If four bases in one DNA strand are A (adenine), G (guanine), C (cytosine), and T (thymine), the…

A: Answer is c.) A, G,C,U.

Q: A strand of DNA has the base sequence 5' GTAACC 3'. Write the base sequence for the complementary…

A: The nitrogenous bases of DNA are adenine, guanine, cytosine, and thymine. Adenine and guanine are…

Q: A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a…

A: DNA stands for Deoxyribonucleic acid. It is the genetic material in humans.

Q: When double-stranded DNA is heated at neutral pH, which change does not occur? O The N-glycosidic…

A: DNA is the genetic hereditary material found in almost all organisms. All cells in our body contain…

Q: Draw the structure of each nucleotide: (a) UMP; (b) dTMP; (c) AMP.

A: Introduction: Nucleotides are chemical compounds that are made up of nucleoside and phosphate. They…

Q: A strand of DNA has the base sequence of AGCCAT (written in the 5' to 3' direction). What is the…

A: Genetic code, the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)…

Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…

A: Transcription: It is the process of synthesis of mRNA from double-stranded DNA by the enzyme RNA…

Q: If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence…

A: Every living organism has Deoxyribonucleic acid (DNA). DNA has a recipe for synthesizing proteins.…

Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…

A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…

Q: Write the sequence of the complementary strand of each segment of a DNA molecule. a. 5 '–AAATAAC–3…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: If the sequence of one chain of a DNA double helix is TAACGTA, the sequence of its partner strand in…

A: Chargaff's rule express that DNA from any species of any life form ought to have a 1:1 protein…

Q: Which of the following is FALSE about DNA? O The two strands are anti-parallel. O The base sequence…

A: DNA is a nucleic acid. Nucleic acids are polymers of nucleotides.

Q: A nucleotide contains which of the following?a. 5-carbon sugar b. nitrogen base c. phosphate d. b…

A: DNA and RNA are genetic material and are formed due to the polymerization of the nucleotides. Thus…

Q: If one of the strands in DNA is made up of 10% guanine, what will be the composition of the DNA? A.…

A: The base complementarity of DNA is defined by the Erwin Chragff rule. Which states that in DNA there…

Q: If the sequence of one strand on DNA is… CTA GCT CCA its complementary strand will be… _____________

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: The two strands of DNA that make up the double helix are held to each other by ... a) hydrogen bonds…

A: DNA is made up of nucleotides which contains three parts: a sugar molecule (deoxyribose), phosphate…

Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…

A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…

Q: equence of nucleotides in a DNA strand is CAT TAG CAT CAT GAC, what will be the base sequence in…

A: Given: CAT TAG CAT CAT GAC: Sequence of nucleotides in a DNA

Q: . You have a sample of DNA, and you measure the amount of adenine present at 21%. Based on this, the…

A: DNA stands for De-oxy ribonucleic acid and it contains four nitrogenous bases along with the sugar…

Q: One species’ DNA differs from others in its______ . a. nucleotides c. double helix b. DNA sequence…

A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…

Q: What is the percentage of cytosine in DNA if the percentage of thymine residues is 28%? A. 22 В. 28…

A: This question can be solved with the help of base pairing rule known as chargaff's rule of DNA base…

Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…

A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…

Q: If one strand of a DNA double helix has the sequence GTCCAT what is the sequence of the other strand…

A: By the rule of complementarity, every A is bound to T and G is bound to C.

Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…

A: The form of DNA, known as a double helix, is made up of two connected strands that loop around one…

Q: The two DNA chains are held together by complementary base pairing between A and T bases and between…

A: DNA are made of Nucleotides . A phosphate group, a sugar group, and a nitrogen base are all found in…

Q: Cuble stranded DNA molecule of 50 base pars (100 nucleotides total) contains 15 cytosine bases (C).…

A: DNA is a double stranded helix which is a hereditary material of organisms. It contains 4 nucleotide…

Q: A DNA helix is found in the _____ form while an RNA helix is found in the _____ form.

A: Answer: Z-DNA is a form of DNA that has a different structure from the more common B-DNA form.It is…

Q: Which of the following is the convention used to specify the sequence of bases in DNA? (A) start at…

A: Answer - option D.

Q: You have obtained a sample of DNA, and you transcribe MRNA from this purify it. You then separate…

A: Deoxyribonucleic Acid is the abbreviation for Deoxyribonucleic Acid. DNA is a nucleotide polymer.…

Q: One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base…

A: Two strands of DNA both are antiparallel and complementary to each other.

Q: A slight change in a single amino acid in polypeptide chain results in Select one: O a. • Mutation O…

A: Amino acids are considered the organic compounds that contain the amino (–NH2) and carboxyl…

Q: Which of the following is true about DNA ? * O Two DNA strands are twisted around each other to form…

A: DNA is the hereditary material in humans and most of the other organism. It is made up of Nitrogen…

Q: For each of these symbols, write out the full name of the base and of the nucleoside. Indicate which…

A: As per the honor code, we answer only three subparts at a time. Therefore, we are answering the…

Q: A small segment of DNA has the following sequence: A – A – T – C – T – C – G – T – A The sequence…

A: DNA is a molecule composed of two polyneuclotide chains coiled around each other in a helical…

Q: What type of bond forms between complementary bases that holds strands of DNA to each other? OA.…

A: DNA Molecule is a double helix molecule where Sugars and phosphodiester bonds make the backbone and…

Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…

A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…

Q: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of…

A: According to the question, one strand of DNA with the base sequence is given, we have to determine…

Q: DRAW IT In a DNA double helix, a region along oneDNA strand has this sequence of nitrogenous…

A: DNA is known as deoxyribonucleic acid. It is made up of two strands. DNA is made up of nucleotides.…

Q: Below is a 6 base sequence of DNA. What type of mutation would result if the fourth nucleotide base…

A: Transcription is the process by which DNA is used to make mRNA . the mRNA Is later translated to…

Q: Complementary strands in DNA double are defined by: a. jonic interactions O b. H bonds O c. С.…

A: DNA is double-stranded and has an anti-parallel helical structure. In DNA double helix two strands…

Concept explainers

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.

Question

I do not know how to do this problem.

Given the following strand of DNA, find:
1. the complementary DNA strand
2. the MRNA
3. the TRNA
4. the amino acids.
3'-ТАС АСС TTT CAА АСТ -5'
***Be sure to number the parts of your answer #1-4.
***Include 5' and 3' where applicable.
Alanine
AGU
A
GU
Tyrosine
Stop
Valine
Cysteine
G Tryptophan
Arginine
C.
ACU
Leucine
Serine u
C
UG
GACU
Lysine
A
Proline
Asparagine
G
ACU GACU
DNA 2.0
Glycine
henyl-
alanine
Glutamic
acid
Aspartic acid
UG
Histidine
Glutamine
O Arginine
Isoleucine
Threonine
Methionine

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
For the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below is the correct order for the nucleotide base sequence in DNA? Group of answer choices a. UGUGCAAAGUUA b. AGACAATTCAAT c. TCTCGTTTGTTA d. TGTGCTTTCTTA
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: T T T A C G G C C A T C A G G C A A T A C T G G mRNA: Codon: Anitcodon:
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on the other half? A. CGATTCCGCAATAGGGG B. GCTAAGGCGTTATCCCC C. CGATGCCGCAATAGGGG D. ATAGGAATACCGCTTTT E. TATCCTTATGGCGAAAA
1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
Please choose the correct answer. Given the sense strand of DNA, A T G T A A C C G C G C A A G G G C A T G T G A, how many amino acids are in the protein coded by this piece of DNA? a. five b. six c. seven d. eight
What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?