What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.

Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…

A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…

A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…

Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'

A: Central dogma consists of replication, transcription and translation.  Replication is the synthesis…

Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.

A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…

Q: If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of…

A: DNA : Deoxyribonucleic acid is a double stranded molecule in which two strands are anti parallel and…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: INTRODUCTION: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: Which of the following combinations are true of the nucleotide composition of a sample of DNA?…

A: Deoxyribonucleic acid (DNA) is the chemical name for the molecule that carries the genetic…

Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT

A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?

A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…

Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…

Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…

A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: What form of DNA corresponds to the Watson-Crick double helix structure?     A form     Z form…

A: DNA, the molecule carrying the genetic instructions in all living beings, is a polymer of…

Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC   Give the RNA…

A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: Match the label on the left with the correct structure number in the DNA molecule in the image…

A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…

Q: If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears…

A: DNA is a deoxyribose sugar nucleic acid that carries genetic information from one generation to…

Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…

A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…

A: The answer is TTTAGCC. The last option.

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…

A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…

Q: What is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds…

A: DNA strands are essentially polymers that comprise of deoxynucleoside monophosphate that are linked…

Q: If one strand of DNA has the sequence A-A-C-T-G-T-G, what will be the nucleotide sequence of the…

A: DNA replication is the process of formation of DNA without using its own template . This process…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…

A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…

Q: Which of the following statements are true about doublestranded DNA?a. A + C = T + Gb. A + G = C +…

A: DNA is formed of molecules known as nucleotides. Every nucleotide molecule is composed of a sugar…

Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…

A:

Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…

A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…

Q: List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G

A: There are four nitrogenous base pairs in DNA  Adenine Guanine Cytosine Thymine

Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…

A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…

Q: Write the base sequence in a complementary DNA segment if each original segment has the following…

A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…

Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…

Q: From the above sequence (DNA: ATGGATCCGCTTTAG), what is the amino acid sequence?

A: - Cells decrypt mRNAs by reading their nucleotides in teams of 3, known as codons. Here square…

Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…

Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…

A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…

Q: If the sequence of base pairs on a DNA molecule are AGATTAGTG, what is the sequence on the…

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…

Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…

A: DNA is the genetic material that involves the transfer of information from one generation to the…

Q: If a region of one strand of a DNA double helix has the sequence 5'-CAGATAC-3', what is the sequence…

A: The nucleotide base pairing is complementary that is two complementary nitrogenous molecules are…

Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: If I have a strand of DNA that has the base pairs as below, what would the base pairs be on the…

A: Adenine complements with thymine and cytosine complements with guanine in a DNA strand. According to…