Haemochromatosis is a recessive disorder caused by mutations in the HFE gene. The disorder can be the result of nonfunctional HFE protein, or from very low levels (expression) of the HFE protein. Below is a northern blot gel showing the amount and size of HFE mRNA for a person who does not have haemochromatosis (WT). The mRNA was loaded at the top of the gel. WT A B C D Position the bands on the gel shown in each question as directed. Part 1 Tom has a mutation which changes the sequence of an enhancer region adjacent to the TATAA box for this gene. Position Tom's band in Lane A. WT A B n D

Haemochromatosis is a recessive disorder caused by mutations in the HFE gene. The disorder can be the result of nonfunctional HFE protein, or from very low levels (expression) of the HFE protein. Below is a northern blot gel showing the amount and size of HFE mRNA for a person who does not have haemochromatosis (WT). The mRNA was loaded at the top of the gel. WT A B C D Position the bands on the gel shown in each question as directed. Part 1 Tom has a mutation which changes the sequence of an enhancer region adjacent to the TATAA box for this gene. Position Tom's band in Lane A. WT A B n D

Name: Part 2Patrice has a mutation that creates an early transcription term
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Part 2Patrice has a mutation that creates an early transcription termination site. Position Patrice's band in Lane B.WT A B C DPart 3Kobe has a single-nucleotide frameshift mutation. Position Kobe's band in Lane C.WTA B C Haemochromatosis is a reces

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
A hereditary disease is inherited as an autosomal recessive trait. The wild-type allele of the disease gene produces a mature mRNA that is 1250 nucleotides (nt) long. Molecular analysis shows that the mature mRNA consists of four exons that measure 400 nt (exon 1), 320 nt (exon 2), 230 nt (exon 3), and 300 nt (exon 4). A mother and father with two healthy children and two children with the disease have northern blot analysis performed. The results of the northern blot for each family member are shown below. a) Identify the genotype of each family member, using the size of mRNAs to indicate each allele. (For example, a person who is homozygous wild type is 1250/1250). b) Based on your analysis, what is the most likely molecular abnormality causing the disease allele?
a. The reading frame DNA sequence is: b. The mRNA sequence is: c. The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of mutation was produced? The mutated polypeptide sequence is What kind of mutation was produced?
Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and write the mature mRNA sequence. Then write the amino acid sequence of the resulting transcript. AGAGCTACCAGCTTTAGCGGGATATAAACACACTTATCCTACTATCCCTA 51 TCTTCCCCCAAAGAGGGATCATGCCGTCGACGGCCAAACCGATCGAGCGG 101 AGGTTAAGGGCCATTGGAAAAGGACACTCTGTACGACTAAGAAAATAGC 151 AGCGACTGAGCTGAACGCTACGGGGGGGGGGGTATATACCCCCCCCCCCC 201 CCAGCTACGAGCGACTTTTTATTTTTTTTTTTTATTTTTTTTCTTTTTTA 251 TTTTTTTTGTTTTTTTTTTTCGCGACTACAGAGACTTCTAGCGATCGACG 301 AGCTAGCTAGCGCGGCATCGGACGCGATCGCGATCCTAGACTCTACGAT
Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.
The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…