HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal valine of a hemoglobin subunit. True False
Q: Fill in the blanks in the table below regarding the similarities and differences between two…
A: The replication of DNA involves opening up a double-stranded DNA molecule and creating a…
Q: What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA…
A: B. Minisatellites - Micro- and mini-satellites, as well as satellite DNA sequences, account for…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: Calculate the free energy change for glucose entry into cells when the extracellular concentration…
A: Free energy change The change in free energy (ΔG) is basically the difference between the heat…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Which statement regarding glycolysis is TRUE? Group of answer choices Both substrate-level…
A: Glycolysis is the process of oxidation of one mole of glucose into two moles of pyruvate. It occurs…
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: Steroids are biologically four ringed organic compounds that act as important components of cell…
Q: Lalculate: You need a digestion buffer consisting of the following: 15 mM NaCI 75 mM Tris-CI, pH 8…
A: The preparation of solutions of given concentrations from the stock solution of the components is an…
Q: Compare and contrast the de novo synthesis of purine and pyrimidine ribonucleotides. Move each…
A: There are two biosynthetic pathways for the synthesis of nucleotides: De novo pathway: The bases are…
Q: Which of the following contain copper atoms (Cu2*) Select one: O a. Complex II O b. Complex III…
A: There are four enzyme complexes of ETC present in the inner mitochondrial membrane. Complex 1-…
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Phenyl alanine hydroxylase is an enzyme that causes phenylketonuria on its deficiency. Phenyl…
Q: Please identify whether the statements below is true or false. Thank you! (Please put a short…
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. Proteins are polymers…
Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…
A: DEAE-cellulose contains an diethylaminoethyl group and is positively charged at neutral pH.
Q: You are required to isolate, purify and verify the purity of an enzyme from cytosol of a plant
A: Enzymes are usually composed of proteins which is specific for its substrate. It has immense…
Q: The circulatory system is a O closed network of arteries, veins, and capillaries O an open network…
A: Circulatory system is one of the important systems of the body involved in various processes like,…
Q: What is the difference between Raman Spectroscopy and SERS ( Surface Enhanced Raman Spectroscopy).
A: Introduction: It is the most powerful tool to study the interactions between matter and…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisacharide made by three monosacharide units galactose Glucose and fructose.…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…
Q: 1. Foods cannot be compared without determining the “per gram" values. Explain the reasoning behind…
A: Nutrients are substances required by the body, for the growth and development, reproduction, and to…
Q: Calculate the fractional charge on ASP at pH 3 using the following pKa values (1. 9.90, 3.90). Write…
A: A total of 300 amino acids are present in the biological system out of the 20 are part of…
Q: Describe the reaction and the products that would occur if transketolase acred upon a pentose aldose…
A: Transketolase is an enzyme of pentose phosphate pathway which accept two carbon from pentose ketose…
Q: Question 5 In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B A.
A: Cell membrane is made up of lipid bilayer. The composition of different types of lipids has very…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: In the RBCs of the patient described above, which of the following would be expected? And give the…
A: Pyruvate kinase enzyme deficiency typically can manifest clinical symptoms on red blood cells…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Н Но H OH HO, OH H HN- a. Glucocerebroside CH3 OH H3C -N-CH,- CH2-0-P-01 HN CH3 b. Sphingomyelin
A: Glucocerebrosides are lipid derivatives composed of sphingosine, fatty acid and a glucose residue.…
Q: Write an equation to describe the catabolism of an aerobic hydrogen oxidizer
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a…
A: BSA is globular proteins. 1kDa = 1.66 * 10-21 gm The molecular weight of BSA precursor protein is…
Q: How many ATP molecules are produced when 6 molecules of glucose enter glycolysis?
A: Glycolysis is a catabolic pathway in which six Carbon Glucose is catabolised into two 2carbon…
Q: Calculate the number of ATPATP generated from one saturated 1212‑carbon fatty acid. Assume that each…
A: Fatty acids are broken down through beta-oxidation in mitochondria. The end product of…
Q: Consider this intermediate in the derivation of the Michaelis-Menten equation. [E] [S] k-1 + k2 [ES|…
A: Km : The concentration of substrate at which enzyme achieves half Vmax-maximum velocity
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: What kind of quality assessment is performed on amylase and why is this important? 2. What are the…
A: Amylase comes under the glycoside hydrolase enzyme family that break down starch into glucose…
Q: What polysaccharide is used as storage of carbohydrates in humans and animals? Group of answer…
A: Carbohydrates – fibre, starches, and sugars — are nutritional elements that the body converts into…
Q: Spinal fluid contains 15 to 45 mg/dL protein. If you were to take a 5.0 mL sample of spinal fluid,…
A: Proteins present in spinal fluid is low in amount and small proteins as compared to blood serum.
Q: blocking the oxidation/reduction reaction can be led to: Select one: O a. produce water Ob. death…
A: Metabolism is a series of interconnected chemical reactions occurring within a cell; the chemical…
Q: 12. You can distinguish epinephrine hydrotartrate from norepinephrine hydrotartrate by: A. Water…
A: Hi, thanks a lot for submitting the multiple questions. As we are allowed to answer one question at…
Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…
A: Okazaki fragments are short stretches of DNA on the lagging strand, which is synthesized in the…
Q: (Q21) A certain protein has a Ką value 107 M1 and other has a K, value of 10° M1. Of two proteins,…
A: Proteins are composed of a linear chain of amino acid sequences attached together via peptide bonds.…
Q: Which metabolic pathway converts glucose into two molecules of pyruvate and ATP? Group of answer…
A:
Q: 18:3CA9,12,15
A: Alpha Linolenic acid is essential fatty acid, highly concentrated in plant oils. Essential fatty…
Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: Which reaction in glycolysis produces ATP as a product? Group of answer choices hexokinase…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: What part of the protein sequence leads to different functions
A: Proteins are peptides , composed of monomers of polymers,Protein function is directly related to the…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: A mixture of Asparagine (pl 5.41) , Aspartic Acid (pl 2.98), Histidine (pl 7.59), Lysine (pl 9.74)…
A: Cation exchange chromatography separates the molecules based on their net negative charge. Cation…
Q: Question 24 CH,-0-C-(CH,)14–CH, CH-0-C-(CH,)16-CH, CH3 сH, —о—р—о—сH, — сн, — N—сH, CH, What is the…
A: Depending on the strut of lipid ,they are classified as simple and complex lipid. Simple lipids are…
Q: Choose the wrong, Release of energy (ATP) comes from the Select one: O a. when the terminal…
A: ATP is the energy currency of the cell.
Q: Match the following lipids with their functions
A: Lipids are the various organic compounds which are insoluble in water. These are- fats, waxes,…
-
HbA1c is a glycated hemoglobin in which a glucose molecule is covalently bound to the N-terminal valine of a hemoglobin subunit.
True
False
Step by step
Solved in 2 steps
- The physical foundation of sickle cell disease is caused by a hemoglobin mutation that is prone to polymerization as a consequence of a surface-exposed valine residue on the hemoglobin molecule. if it is true or untrueSickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.Sickle-Cell Anemia is one disease that arises from a known point mutation in a protein. This statement is: True False
- The T-state of hemoglobin is favored over the R-state in blood under which of the listed conditions?The amino acid in Hemoglobin that is most found to be most sensitive to pH changes, and hence affects Oxygen binding process around pH 7 is Valine Tyrosine Histidine Aspartic AcidIn a molecular disease of hemoglobin, Hemoglobin Rainier, Tyr 145β is replaced by Cys, which forms a disulfide bond with another Cysresidue in the same subunit. This prevents the formation of ion pairs that normally stabilize the T state. How does hemoglobin Rainier differ from normal hemoglobin with respect to the Hill coefficient
- how do salt bridges that include amino-terminal carbamate stabilize the deoxy form of hemoglobin. Please answer it asap.... With detailed explanation...A pyrimidinr always pairs with a ___________Multisubunit proteins in which some or all of the subunitsare identical are referred to as _______________________.
