5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the first AUG as triplet codon ?

Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…

A: The figure shows the process of translation.Translation is the process in which ribosomes in the…

Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…

A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…

Q: 23. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…

A: When protein synthesis has been started, each new amino corrosive is added to the lengthening chain…

Q: The peptidyltransferase reaction begins with the hydrolysis or breaking of the bond between the…

A: The translation is the process in which the genetic code carried by mRNA is decoded to produce the…

Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…

A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…

Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…

A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…

Q: Taking start and stop codon into consideration, if we have an mRNA sequence with 30 nucleotides, how…

A: Peptides are peptide bonds that connect short chains of amino acids. Dipeptides, tripeptides, and…

Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…

A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…

Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…

A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…

Q: elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit…

A: Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…

Q: 18. The free energy contribution of base pairing (AG released) is negative and single- stranded RNA…

A: G-C pair form three hydrogen bonds with each other. DNA with high G-C content is more stable.

Q: Given this MRNA strand: 3 - AUGAGGAAGGUA - 5"; what are the components of the polypeptide?

A: The polypeptide is formed by decoding the triplet codons using the codon table given.  The mRNA…

Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…

A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .

Q: Given this mRNA strand: 3’ -   AUGAGGAAGGUA   - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: 13. The codon for the amino acid methionine (met) is AUG. What is the corresponding anticodon found…

A: Amino acids are the building blocks of proteins where the combination of 20 different proteins helps…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: 4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open…

A: Codons are triplets of nucleotides, which codes for specific amino acids. The open reading frame is…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…

A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…

Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…

A: As per the guidelines we are supposed to answer only the first question in case of multiple question…

Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…

A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added.  2. Given the…

A: Since it is a multipart question we are supposed to answer only the first three questions as per the…

Q: bust me int Tly di gerlarat bu nd ambigu 22. Some tRNAS contain inosine, which can base pair with A.…

A: A transfer RNA or tRNA:It is a special type of RNA molecule. It helps in matching of an amino acid…

Q: 26. Once a polypeptide chain has begun growing during protein synthesis, an incoming RNA carrying…

A: Ribosomes synthesize proteins. Proteins are formed from amino acids. 70S ribosomal complex is…

Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: 11. Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer…

A: Replication is the process which makes DNA from the parental strand of DNA.  Transcription is…

Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…

A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…

Q: 21. mRNA serves as template for the synthesis of polypeptide.  true or false

A: The translation process is by which organisms forms protein or a polypeptide chain.

Q: 22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous…

A: The interaction between the molecular surfaces occurs due to various reasons. The reasons…

Q: C9. The peptide “backbone" consists of repetitive "“units" of amino group nitrogen-alpha…

A: Proteins are biopolymers made of amino acid units. Amino acids are comprised of carbon, hydrogen, a…

Q: Given the going with molecule of DNA: strand 1 – A T G C G C T A C G C A T–strand 2 – T A C G C G A…

A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…

Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3

A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…

Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu

Q: Put the following events in the synthesis of a polypeptide in the proper order.   An initiator tRNA…

A: Ribosomes are the made of RNA and proteins. During translation m RNA is processed in the ribosome…

Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…

A:

Q: 32.) Translate the following mRNA into protein primary structure. Use the ONE-LETTER abbreviations…

A: Note: You have asked multiple independent questions and thus we have solved the first question for…

Q: 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an…

A: answer The tRna with which amino acid attached will enter A site will be  CCC codon which codes for…

Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…

A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…

A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.

Q: 22. Which of the following mutations would be expected to have the most harmful effect on the…

A: Mutations Mutations are defined as any change or alteration in the base sequences of the DNA further…

Q: 4. How many codons are in the longest ORF? 5. What is the frame of the shortest ORF? 6. How many AA…

A: ORF is a stretch of DNA sequence that begins with translation initiation site (start codon) and ends…

Q: 2. Of the hundreds of confirmed tRNA genes in the human genome, only one has the sequence 5' ATT 3'…

A: The anti-codon present recognizes the codons present on the mRNA in the cognate tRNA. The…

Q: 1d) What amino acid would a tRNA with the anticodon 5'AGG³' carry?

A: The amino acids are the fundamental structural unit of proteins. There are 20 amino acids that code…

Q: 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs…

A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…

Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…

A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…

Q: 11. A mutant bacterial cell has a defective aminoacyl synthase that attaches a lysine to tRNAs with…

A: Proteins are polymer of amino acids which perform specific functions in the cell, mutations happen…