DNA Protein Wild-type Gene GCCGAA Ala Ala-CH₂ Glu Ser GM AGC What is the subject of the figure Functional entyme Cataly HO-S Mutant Gene GCC AA AGC... Ala Single nucleotide change Ala-CH₂ Lys Sa HO Defective enzyme
Q: Active transport requires energy released by an exergonic process such as the formation of ATP…
A: Active transport system requires energy in order to allow the movement of molecules, mostly the…
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: Predict the amino acid sequence based on the conditions below. Use the one-letter abbreviation of…
A: Amino acids are building block of polypeptide chain. its alpha carbon contains carboxyl group, amine…
Q: Which of the following statements correctly describe(s) the general structure of steroids? a.2…
A: A steroid is an organic compound that is biologically active and has four rings arranged in a…
Q: Part 1: Draw the following metabolic pathways and identify different types of organic reaction…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: 2. Polar covalent bonds occur due to the equal/unequalsharing of [protons/ electrons (Highlight or…
A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…
Q: Which of the following statements is/are TRUE for the promoters? The Pribnow box and TATA box are…
A: A promoter is a short region of DNA upstream of gene where RNA Polymerase recognizes the start site…
Q: The transcription initiation factor “recruited” together with RNA-Pol II in the formation of…
A: Transcription is a process of making an RNA copy from a gene’s DNA sequence. This is known as…
Q: Metabolite common between Krebs’ cycle and β-oxidation cycle? A. pyruvate B. acetyl-CoA C.…
A: Krebs cycle is the second stage of cellular respiration in which Acetyl CoA is harnessed for its…
Q: A) What would you expect to happen if you added ddCTP to a DNA synthesis reaction in vitro in large…
A: ddCTP is 2',3'-Dideoxycytidine-5'-triphosphate. It does not contain a 3’OH group in the deoxyribose…
Q: You need to use a dilute hydrochloric acid solution in an experiment. However, the only bottle of…
A: The pH scale is a scale used to specify the acidity or basicity of an aqueous solution. A strong…
Q: 1. Explain why egg white and milk are used as antidotes in heavy metal poisoning. 2. Surgical…
A: 1. The egg white and milk are used as antidotes for heavy metal poisoning because the egg white and…
Q: Use the diagram which represents a spontaneous reaction to answer the questions. Is the reaction…
A: A spontaneous reaction is the reaction that is capable of directing the reaction in forward…
Q: In the Krebs cycle, how many H20 molecules are required for every glucose molecule? a.2 b.4 c.6…
A: Kreb's cycle is also called as citric acid cycle or TCA (Tricarboxylic acid cycle). It is a common…
Q: The phospholipids in the outer leaflet of the plasma membrane of a human cell are fluorescently…
A: The plasma membrane of an animal cell is majorly composed of phospholipids. The phospholipids form a…
Q: Which of the following statements is/are TRUE for both replication and transcription? Polymerase…
A: DNA replication is the biological process of producing two identical copies of DNA from a double…
Q: 10 of these are soluble proteins and 10 are integral membrane proteins. Group (cut & paste, circle…
A: Integral membrane proteins are those that will be found spanning a membrane. They will have regular…
Q: Experiment used to confirm the type of inhibition exerted by AZT on the HIV reverse transcriptase…
A: AZT is a substrate analog of thymidine. Thymidine is a substrate of the reverse transcriptase used…
Q: Which of the following amino acids can be converted to ketone bodies? a.Ala b.Arg c.Lys…
A: Amino acids can be degraded & during degradation, they can form various intermediates. Depending…
Q: CHM3413-Neutral vs lonized consider the table of drugs shown below and their respective pka…
A: The compound left over after an acid gets deprotonated is called its conjugate base. The compound…
Q: Explain why based on the FRET data.
A: FRET (Fluorescence Resonance Energy Transfer) is a technique to tell whether proteins are…
Q: Which three classes of amino acids would you most likely find lining the surface of a globular…
A: The proteins are composed of twenty naturally occurring amino acids. Amino acids can be classified…
Q: Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino…
A: Genetic code is a set of rules that are followed in translation of genetic material in the form of…
Q: Membrane proteins with specialized functions and distinct from other membrane proteins may be…
A: There are various types of proteins found throughout the cell membrane. Many of them are present…
Q: The retention factor, Rf is measured: Any place in a spot - some of the molecules migrated there. At…
A: Rf means retention factor in a thin layer of paper chromatography. A solute or mixed sample is…
Q: What are the relative percentage (%) of species (B) and (C) at pH 7.2? (Note: treat pka's as…
A: Amino acids contain an alpha-amino group, an alpha-carboxylic group, and a side chain. The side…
Q: Which of the following statements about the "central role" of TCA is/are correct? a. Some metabolic…
A: Kreb's cycle is also called as citric acid cycle or TCA (Tricarboxylic acid cycle). It is a common…
Q: different properties of the head and tails of phospholipids (polar, hydrophilic, nonpolar,…
A: Phospholipids are lipids with phosphate groups and are a crucial part of cell membranes. The…
Q: Type of chlorophyll only found in eukaryotes. a.Chl b b.Chl a c.Chl d d.Chl c
A: Introduction: The green color of the plant is due to this chemical called chlorophyll which is used…
Q: Which statement is/are TRUE about inhibitors? A. Mode of action of penicillin on bacteria is an…
A: Inhibitors are the molecules that show impact on the enzyme activity. They interact with Enzymes in…
Q: Coenzyme A binds to an acetyl group via a __________ linkage. A. carboxylic acid ester B.…
A: Enzymes are a molecule that acts as catalysts in the reaction. Coenzymes are organic compounds like…
Q: What are the charges of the following amino acids peptides at ph 14? 1. GLAVV 2. RRKKQ
A: Peptide chain is a short chain of amino acids joined by peptide/amide bonds (covalent bond). The…
Q: Give some options choose the structure of coenzyme that is not derived from a vitamin and provide…
A: Coenzymes are the type of cofactors required for the functioning of the enzymes. These are complex…
Q: 5a) Draw this peptide at the physiological pH (7.4) with the following 1-letter codes: F-R-I-D-A-Y…
A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…
Q: c) Show resonance structures for the protonated version of Arginine's side chain. d) Show all the…
A: Arginine is a basic amino acid and arginine side chains are protonated under physiological…
Q: 3. The sample solution gives po sitive ninhydrin and Foli's tests. What substances are expected to…
A: Ninhydrin and foli's tests are used to detect amino acids with certain properties. Amino acids are…
Q: is the active component in Benedict's Reagent is the storage from of carbohydrates in plants is the…
A: These tests are used to detect the presence of carbohydrates or reducing sugars or the presence of…
Q: Determine the Primary amino acid sequence of an Octapeptide Composition · Tyr , Arg，Pro, Lys ,Lys…
A: Introduction Amino acids are building block of proteins. Amino acids contain both amino and…
Q: 1. Below is a free energy graph for the chemical reaction A + B àD.
A: Free energy is used to determine the state of the any reaction, i.e. how can systems change and also…
Q: describe how 18O from water can end up in C18O2. Feel free to draw structures and reference any…
A: We know that the end product of glycolysis is pyruvate which to enter citrate cycle cycle for…
Q: 1. Look for the meaning of the following words: • a. Pre-eclampsia Neurotransmitter . b. c.…
A: A neurotransmitter is a signaling mediator that is secreted by a neuron and can affect another…
Q: Now, assume that a hypothetical two-subunit hemoglobin has an n of 2. The ratio of the…
A: Our hypothetical Hemoglobin (Hb) consists of 2 subunits . 'n' denotes the number of binding sites in…
Q: Histidine is an amino acid with three ionizable groups, one of which has a pKa of 6.0. This group,…
A: pKa of an amino acid changes with a change in PH of the medium. An amino acid has three groups…
Q: 2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then…
A: DNA is the genetic element of the cell. By definition the relative amounts of repeated and unique or…
Q: What are pantothenic acid and biotin? Explain how these molecules are important to cellular…
A: The cell perform multiple metabolic pathways in order to maintain the life processes. The major…
Q: Which of the following statements is/are TRUE for photosynthesis? The e- moves from H20 to NADP+.…
A: Photosynthesis occurs in two phases- light phase and light independent phase (commonly known as dark…
Q: 6) Proline is not commonly found in the middle of a-helices because its ring structure prevents it…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: Compare and contrast Hb and Mb in terms of the following: • Physiological roles • Structures • O2…
A: Hemoglobin and Myoglobin are used as classic models for studying protein-ligand interaction. Both…
Q: Of the components in the hydrogels beads, which is the protein we are interested in measuring?
A: Hydrogel beads are cross-linked mesh of hydrophilic polymers which is composed of spherical shaped…
Q: In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site…
A: Translation is process by which the cells produce protein from the information provided by the DNA.…
Step by step
Solved in 2 steps
- To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
- Mutations in the dnaA gene of E. coli are lethal and canonly be studied following the isolation of conditional,temperature-sensitive mutations. Such mutant strains grownicely and replicate their DNA at the permissive temperatureof 18°C, but they do not grow or replicate their DNA at therestrictive temperature of 37°C. Two observations were usefulin determiningthe function of the DnaA protein product.First, in vitro studies using DNA templates that haveunwound do not require the DnaA protein. Second, if intactcells are grown at 18°C and are then shifted to 37°C, DNAsynthesis continues at this temperature until one roundof replication is completed and then stops. What do theseobservationssuggest about the role of the dnaA gene product?The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG GACGTC On the resulting DNA fragments are left 3’ overhanging ends of 4 nucleotides. PstI cleavesthe phosphodiester backbone with a-type specificity. In short-hand notation, showing theidentity of phosphates on the ends, draw the two fragments that result from PstI digestion ofthe following double-strand ed oligonucleotide: 5’-pAATTGCTACTGCAGAACCGG-3’ 3’-TTAACGATGACGTCTTGGCCp-5’
- . The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with others, is a powerful method to study enzyme mechanisms. In experiments with particular enzyme, various lysine residues were replaced with aspartate, yielding the results summarized in the table below: Enzyme Form: Enzyme Activity (U/mg) Native enzyme: 1,000 U/mg Recombinant Lys 21 to Asp 21: 970 U/mg Recombinant Lys 86 to Asp 86: 100 U/mg Recombinant Lys 101 to Asp 101: 970 U/mg a. What might be inferred about the role of Lys 21, 86, and 101 in the catalytic mechanism of this enzyme? b. Discuss where within the enzyme one might find Lys 21 and 101. Are these residues likely to be evolutionary conserved in this enzyme? Explain c. Is Lys position 86 likely to be evolutionary conserved? ExplainThe amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?
- Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2, (b) bromouracil, and (C) 2-aminopurine.Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.The Enzymatic Activities of DNA Polymerase I (a) What are the respective roles of the 5 -exonudease and 3 -exonuclease activities of DNA polymerase I? (b) What might be a feature of an E. coli strain that lacked DNA polymerase I 3 -exonuclease activity?
