Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is anexample of amutation.DNA:АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТProtein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-PheDNA:ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT TProtein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe-missensenonsenseantisenseO frame-shiftsilent

Name: Compare the two DNA sequences shown below and consider the single nuc
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is anexample of amutation.DNA:АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТProtein: Met-Arg-Ser-His-Leu

Gene mutations involve alteration in the structure of genes which alters or modifies the structure…

Science

Biology

Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC TCC CAT CTT AAC AAA GAG GTT GGC TAT TTT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC TCс САТ СТТ ААС САА AGA GGT TGG CТА ТТТ Т Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- O missense nonsense antisense O frame-shift silent

Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC TCC CAT CTT AAC AAA GAG GTT GGC TAT TTT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC TCс САТ СТТ ААС САА AGA GGT TGG CТА ТТТ Т Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- O missense nonsense antisense O frame-shift silent

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each of the following situations: a) ABCCDEFGH b) ABCDEGH
If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a.) AGC (ser): ________b.) UGU (cys): ________c.) GGC (gly): _______d.) UGA (stop): _______e.) UUC (phen): _______
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand. First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide.
Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?