Answered: How many PAM sequences are present in…

How many PAM sequences are present in the sequence below? 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3' O 2 O 3 O4 O5

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2VQ

See similar textbooks

Related questions

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…

A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…

Q: If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is…

Q: If a polypeptide chain is 30 amino acids, how many nucleotides will make up the coding mRNA strand?…

A: Amino acids are the monomers that join together by peptide bond formed between the carboxyl end of…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: What structure is represented by 3 on the diagram? -5 Koopa -6 1 -4 3 |- PJ PG 9 7 7 7 7 7 7 7 7…

Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Which one of the following statements is true? Select one: O a. It takes three genes to code for one…

A: Gene can be defined as the segment of DNA. It contains information about the genetic characteristic…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: Which one of the following statements is true? Select one: O a. Each gene codes for three proteins O…

A: In order to form proteins, DNA codes for m RNA and t RNA through the process of transcription. Both…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…

A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: How many potential methylation sites are present for the following DNA strand?…

A: 3 types of methylation sites. option 2 is the correct answer. Count the number of "C"s and "T"s at…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: How many possible open reading frames (frameswithout stop codons) exist that extend through the…

A: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the…

Q: Which is the DNA template given if the MRNA O 3- GCCTACGGGCATATGGTA -5 JACGUA -3

A: During transcription mRNA is generated from DNA by the process called transcription .and then this…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…

A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…

Q: Which of the following is the consensus sequence of the Kozak sequence?. O 5'AGGAGGU 3' 0 5 ТАТААТ…

A: Please follow step 2 for detailed explanation.

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…

A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…

Q: Will the pairs of sequence might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′…

A: Insertion is the expansion of at least one nucleotide base sets into a DNA (deoxyribonucleic…

Q: If pET32a(+) is digested simultaneously with BamHI and BclI, 5.1. How many fragments are created?…

A: pET-32 is a unique sequence outlined for cloning and high-standard peptide sequences expression.

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a…

A: The mutation is simple known to state towards the a term that used to describe a change in the…

Q: What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’

A: Transcription: Transcription is a process where the DNA is used as a template to synthesize mRNA.…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: Below is a sequence of DNA.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows, TGC GTG TAC CTA CCA

Q: What is the complementary sequence of the given nucleic acid sequence? (write your answer in the…

A: Introduction : The rules of base pairing (or nucleotide pairing) in DNA are: A with T: the purine…

Q: What amino acids do the following sequences code for?(a) AUC (b) GCU (c) CGA (d) AAG

A: A codon is a nucleotide sequence of the nitrogenous base which codes for specific amino acids.the…

Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC

A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…

Q: Which of these single strand RNA sequences could form a hairpin secondary structure? 5'…

A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…

Q: Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see…

A: DNA consist of nitrogenous bases, sugar and phosphate groups. The specific sequence of nucleotides…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…

A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…

Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…

A: AAG ATA CAG GCT CGG TAA : DNA

Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…

A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…

Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…

A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…

Question

100%

How many PAM sequences are present in the sequence below?
5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3'
O 2
O 3
O 4
O5
0 6

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?
What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCA
Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
How many possible open reading frames (frameswithout stop codons) exist that extend through the following sequence?5′... CTTACAGTTTATTGATACGGAGAAGG...3′3′... GAATGTCAAATAACTATGCCTCTTCC...5'
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′
How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'