Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.               DNA        AAT  GGT  CCA  CCG  CTG                         mRNA  Amino Acids                                                                                                             UUA= leucine                                                                                                             GAC= asparginine                                                                                                             GGU= glycine                                                                                                             GGC= glycine                                                                                                             CCA= proline

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: Which of the following could be the mRNA codon, the codon on the DNA sense strand, and the codon on…

A: DNA => Transcription => mRNA => Translation => Protein. In DNA: 5' - 3' strand is called…

Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…

A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: Fill in the Amino Acids the original strand of DNA and its matching RNA strand will code for. TAC…

A: When DNA encodes mRNA then this process is called transcription. When mRNA encodes protein then this…

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: According to Bartleby guidelines only the first question in case of multiple questions have to be…

Q: A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence:…

A: When a single base nucleotide is changed, it is called as point mutation.  Non sense mutation, is a…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: Select the correct complementary strand of DNA for the following DNA sequence ATG GGG CGG ATA TAC…

A: Deoxyribonucleic acid, better known as DNA, is a major gene for most of life. Some viruses use…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…

Q: The following is the base sequence of an exon portion of a template strand of a DNA molecule: 5'…

A: Introduction :- DNA acts the genetic material , present within the nucleus of a cell . It is a…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…

A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…

Q: If given the following coding strand of DNA, what is the mRNA?  What tRNA will be present?  (hint -…

A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: The DNA sequence of the coding strand is shown below; which reading frame most likely codes for a…

A: Start codon in translation is AUG in RNA and ATG in the DNA sequence that codes for methionine amino…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…

A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?

A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .

A: DNA is a double helical molecule, in which two complementary strands are held together with the help…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…

Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…

A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…

Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…

A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…

Q: Given the following DNA strand, which of the following is its complementary MRNA? G GACIGATT"…

A: Transcription and translation are two processes of gene expression. The process of the formation of…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: A Section of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the…

A: \protein synthesis in a cell is a very important function. The information for protein synthesis is…

Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT

A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…

Q: Which statement is true regarding the number of start (initiation) and STOP codons in the standard…

A: Genetic code carries the information present in mRNA in the form of nitrogen bases, for the…

Q: Given the following strand of DNA, find: 1. the complementary DNA strand 2. the mRNA 3. the TRNA 4.…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: Transcribe the corresponding mRNA strand from the given DNA strand:    DNA:     TAC       GCA…

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid.  It is the genetic material of all…

Q: Provided below are strands of DNA. The first one has been done for you. First transcribe the code…

A: Answer: CENTRAL DOGMA = It is the complete process of replication of DNA , transcription of RNA ,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.