Q: Explain The DNA Code in 200-300 words.
A: Please follow step 2 for detailed explanation.
Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…
A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…
Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Convert the following sequence into protein strand using one letter code:…
A: The protein is made by the post-translational modification of peptide chains, and these peptides are…
Q: Transcribe the following DNA strand into MRNA and translate that strand into a polypeptide chain,…
A: DNA is made up of small units known as genes. These genes store all the hereditary information which…
Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…
A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…
Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…
A:
Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein: AUG UCA CGC…
A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…
A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart…
A: The series of mechanism by which a DNA sequence is is transcribed into RNA, and mRNA is translated…
Q: Define Sense codon as they apply to the genetic code
A: Sense codons are those codons which specify amino acids at the time of protein synthesis…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: then translate the resulting mRNA using the gentic code table below. Choose the correct sequence of…
A: The flow of genetic information in cells from DNA to messenger RNA ( mRNA) to protein is identified…
Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…
A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…
Q: create a summary of the nucleotide pairs during the translation process
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…
A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA
A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…
Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…
Q: Use the following DNA sequence, and write the resulting messenger RNA sequence
A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…
Q: Why is DNA and not any other macromolecule represents the genetic code?
A: Biomolecules are organic compounds found in living organisms. All living organism will have these…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: ANSWER;-
Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…
A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…
Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…
A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…
A: Note - We answer one question at a time. The set of rules through which information in the DNA or…
Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…
A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine
Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…
A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…
Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. 2. RNA - AAA UUC…
A: Answer- Proteins are synthesized from the mRNA that itself is formed from the DNA strand by DNA…
Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: Introduction : The genetic code is the set of rules by which information encoded within genetic…
Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…
A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…
Q: Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’
A: Transcription is the process in which the information present on the DNA is transferred on to a…
Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…
Q: Using the genetic code below, decipher the following mRNA sequence.…
A:
Q: Translate the following DNA to RNA and from RNA to amino acid sequence using the help of Codon…
A: The process of conversion of DNA into an mRNA is called transcription. mRNA acts as a template for…
Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…
A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…
Q: Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence:…
A: So the given m-RNA code for - met-glu-ser-leu-leu.
Q: T-A-C |А - А - G А - т-G G-G-G А -т-т DNA enter answer - enter answer enter answer - enter answer…
A: DNA mRNA TAC AUG AAG UUC ATG UAC GGG CCC ATT UAA
Q: The genetic code is a complete, unabridged dictionaryequating the four-letter language of the…
A: Genetic code is the set of rules, encoded in genes for translation of proteins in living cells. The…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the…
A: The genetic code is the set of rules used for translation of the information encoded within genetic…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code
A: Codon is a trinucleotide sequence of nucleic acids which corresponds to specific amino acids.…
Using the genetic code, interpret the following set of
Step by step
Solved in 2 steps
- If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveIf the genetic code used 4 bases at a time, how many amino acids could be encoded?How many kilobases of the DNA strand below will code for the protein product?
- Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCCIdentify the dinucleotide CA repeat region and the score in the following sequence:TGGCACACTCACACCACACAGACAGTTA
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
- draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGWrite a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATAUsing the genetic code below, decipher the following mRNA sequence. 5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)