Which of the following feature of mature mRNAs protects them from premature degradation by cellular exonucleases? Question 1 options: 5'-methylguanosine cap poly(A) tail consensus sequences 5'-methylguanosine cap and poly(A) tail

Which of the following feature of mature mRNAs protects them from premature degradation by cellular exonucleases? Question 1 options: 5'-methylguanosine cap poly(A) tail consensus sequences 5'-methylguanosine cap and poly(A) tail

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Related questions

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

Q: What function do the 5' cap and the poly-A tail serve on a eukaryotic mRNA?

A: DNA is a long polymer of deoxyribonucleotides. It is an acidic substance present in the nucleus,…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…

A: Ans... a base substitution in an enhancer region

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…

A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are primer widely used for cDNA the synthesis generation of a high frequency of…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…

Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…

A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: Which of the following is not something commonly associated with eukaryotic MRNAS? 1. Splicing of…

A: Messenger Ribonucleic acid [m-RNA] is formed inside the cell by the process of transcription. The…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: What molecular biology strategy can best be used to determine Inhibition of the splicing of one…

A: In eukaryotic genes, introns exist. They are interstitial sequences (80-10,000 bp). They do not code…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: Genetics is the study of how traits are passed from one generation to another. This includes but is…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…

A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…

Q: A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this…

A: In the normal hemoglobin molecule protein, has a glutamic acid (an amino acid) at the sixth position…

Q: In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the…

A: In the context of cell biology, the rate of mRNA translation into cellular proteins called…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…

A: Alternative splicing is a method through which a messenger RNA may control the creation of many…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…

A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…

Q: What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating…

A: The messenger RNA (mRNA) is a molecule produced during the process of transcription where the enzyme…

Q: Select the three post-transcriptional modifications often seen in the processing of mRNA in…

A: 5'-capping; 3'-poly(A) tail addition; splicing

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot…

A: mRNAs are formed in the form of primary transcripts.

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and…

A: DNA is the genetic material and is present in the nucleus of the eukaryotic cells.

Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap…

A: Inside the cells of any organism, RNA is considered an essential biomolecule as it performs a…

Q: Given the mRNA sequence below, 5'-UUCCCAAAGUAU-3' Answer the following below: 1. What is the…

A: mRNA synthesis is carried out by the RNA polymerase enzyme. DNA acts as a template for the synthesis…

Q: Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a.…

A: Nucleotides The bases found in the molecules of DNA are known as nucleotides. They are the building…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: The human genome contains thousands of sequences known as small open reading frames, some of which…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter,…

A: The 5′ UTR is located in the first exon of the gene.

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

Which of the following feature of mature mRNAs protects them from premature degradation by cellular exonucleases?

Question 1 options:

5'-methylguanosine cap

poly(A) tail

consensus sequences

5'-methylguanosine cap and poly(A) tail

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Human wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?
In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule? Group of answer choices Because a guanosine cap has to be removed Because exons have to be removed Because a poly-A tail has to be removed Because introns have to be removed Because the RNA primer has to be removed
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene contains three exons. Identify the following items and, for each item, give a brief description of its function: a. Exons b. Poly(A) tail c. 5′ cap
The hypothetical mRNA sequence below contains the coding region for a short peptide. What consequence for this peptide does the substitution of the uracil at position 28 of the mRNA with guanine have? GGUUGAAUGGAACAACGCGUGCACCCUUAGAGGUAACCCUCC | G Group of answer choices No consequence, it is a silent mutation. It shortens the peptide by two amino acids. It destroys the start codon of the peptide coding region. It extends the peptide by two amino acid. It replaces one of the original amino acids of the protein with a different one.
One of the most confusing aspects of determining the protein sequence that will be derived from a gene is keeping track of the polarity or directionality of each nucleotide sequence strand. Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating sequence 5’-UUUGGGUUUGGGUUUGGG-3'?
Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene contains three exons. Identify the following items and, for each item, give a brief description of its function: a. 5′ untranslated region b. Promoter c. AAUAAA consensus sequence
In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the poly-A tail near the 5’ cap. How might this increase translation efficiency?
How would the deletion of the following sequences or features most likely affect a eukaryotic pre-mRNA? a. AAUAAA consensus sequence b. 5′ cap c. Poly(A) tail