If an MRNA is alternatively spliced, thendifferent introns are removed from a pre-MRNA, producing transcripts that will potentially encode proteins with different primary structures.I.the MRNA is found in a bacterial cell.II.transcription and translation of the MRNA will occur simultaneously.the alternative splicing happened in the cytoplasm.IV.Ay different exons from a pre-mRNA will be spliced together.V.the different MRNAS will all have poly-A tails.VI.

Name: If an MRNA is alternatively spliced, thendifferent introns are remove
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: If an MRNA is alternatively spliced, thendifferent introns are removed from a pre-MRNA, producing transcripts that will potentially encode proteins with different primary structures.I.the MRNA is found in a bacterial cell.II.transcription and transl

Alternative splicing is the process of splicing different combinations of splice sites with a…

Science

Biology

If an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing transcripts that will potentially encode protei 1. the MRNA is found in a bacterial cell. I1. transcription and translation of the mRNA will occur simultaneously. I. the alternative splicing happened in the cytoplasm. IV. different exons from a pre-mRNA will be spliced together. V. the different mRNAS will all have poly-A tails. VI.

If an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing transcripts that will potentially encode protei 1. the MRNA is found in a bacterial cell. I1. transcription and translation of the mRNA will occur simultaneously. I. the alternative splicing happened in the cytoplasm. IV. different exons from a pre-mRNA will be spliced together. V. the different mRNAS will all have poly-A tails. VI.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
Imagine that you and your colleagues are working in a lab to develop a protein synthesis system for a new type of synthetic cell. During your brainstorming sessions, you propose that polycistronic mRNA would be much more useful than mRNA that is only translated into one protein. This would allow for multiple proteins necessary for a particular function to be translated together. One of your colleagues says that is a good idea, but if you decide to go with polycistronic mRNA, you’d better make sure to use a prokaryotic translation system. Why might it be problematic to use a eukaryotic translation system with polycistronic mRNA? Mention three reasons:
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
Below is a graphical representation of eukaryotic precursor mRNA. A. Outline each modification that must happen to get a mature m-RNA. B. How does the absence of introns in prokaryotic genes affect prokaryotic gene expression? C. How will gene expression be affected if all of the spliceosomes are removed from the bacteria sample? Explain.
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence of the transcribed Mrna?
Which of the following is not a function of the 5’ cap and 3’ poly-A tail of a mature eukaryotic mRNA molecule? a. To facilitate splicing b. To prevent mRNA degradation c. To aid export of the mature transcript to the cytoplasm d. To aid ribosome binding to the transcript