II Pause (AKS 8a, DOK 2) A transgenic organism receives genes from other organisms. The newly formed DNA is recombinant DNA. The picture above shows several transgenic plants of corn. You are an expert in transgenic plants and need to assist a farmer in growing a new transgenic strain of corn that will produce more food that is resistant to pests and can tolerate drought. What is the worst question fora farmer to ask when determining whether or not to grow transgenic plants? O A. Will the transgenic plant require more pesticides? ов. Will the transgenic plant offer any information in studying human genes? С. Will the transgenic plant help the farmer to increase seed supply? D. Will the transgenic plant help to increase the food supply?

II Pause (AKS 8a, DOK 2) A transgenic organism receives genes from other organisms. The newly formed DNA is recombinant DNA. The picture above shows several transgenic plants of corn. You are an expert in transgenic plants and need to assist a farmer in growing a new transgenic strain of corn that will produce more food that is resistant to pests and can tolerate drought. What is the worst question fora farmer to ask when determining whether or not to grow transgenic plants? O A. Will the transgenic plant require more pesticides? ов. Will the transgenic plant offer any information in studying human genes? С. Will the transgenic plant help the farmer to increase seed supply? D. Will the transgenic plant help to increase the food supply?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 4QP: Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods...

See similar textbooks

Similar questions

A F- recombinant is only made after conjugation of a ________ strain with a _______, while an ______ may become a ______ if the F DNA is tranferred in its entirety. Check all that apply-- a.HFR Strain / F- / F-/ F- Recombinant b.HFR Strain / F- / F-/F+ c.HFR/ F- / F- / HFR d.F+ / F- / F-/F+ e.F+ / F- / F-/ HFR
Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?
You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies of a short, tandemly repeated DNA sequence. PCR is used to determine the number of alleles present, as shown by the size of the DNA fragment amplified. In the Figure below are the results of PCR analysis for STR alleles at a locus where the repeat unit length is 9 bp, and alleles are known that have 5 to 11 copies of the repeat. Given the STR alleles present in the adults, state whether each of the four juveniles could or could not be an off-spring of those two adults. Explain your answers.
What Are Clones? Cloning is a general term used for whole organisms and DNA sequences. Define what we mean when we say we have a clone.
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
a.) wanting to clone gene Z into pVector, the gene is amplified by PCR and restriction sites are added to the flanking ends. without realizing that the antibotic resistant gen )tetR) had a Sal1 site, you decide to add EcoR1 and Sal1 recofnition sequencen into the 12-nucleotide primers. Write the sequence of the 2 primers, noting the 5' and 3' ends?
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time (C0t1/2). Plot a graph below that describes how genome sizes of MS2, T4 and E.coli affects the half-reaction time.
On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
After you did the amplification by PCR, you run the product on 2% gel. Tell me how did you prepared the gel if the tray is 150 ml? how many milliliters of the TBE and how many grams of the Agarose? Draw a picture (On a paper or on computer) for the gel that you are expecting, the gene that you amplified is approximately 200 bp