Page 6 of 6 Describe the cloning vectors that would be used to clone each of the following DNA fragments: 1000 bp CDNA, 8000 bp eukaryotic gene fragment, 100,000 bp segment of a chromosome. 2leongsib 1olbrns donesas i boau ons vodb worl to slqmsxo ns sbivo1 Sa9 HE

Page 6 of 6 Describe the cloning vectors that would be used to clone each of the following DNA fragments: 1000 bp CDNA, 8000 bp eukaryotic gene fragment, 100,000 bp segment of a chromosome. 2leongsib 1olbrns donesas i boau ons vodb worl to slqmsxo ns sbivo1 Sa9 HE

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Related questions

Q: Which activity of E. coli DNA polymerase I is responsible for proofreading the newly synthesized…

A: The first known polymerase is the DNA Polymerase I. It is the enzyme that participates in…

Q: What part of the genome is used for a genetic fingerprint? A Introns Ministe OC. Chromosomes OD…

A: DNA fingerprinting is a technique that shows the genetic makeup of living things.

Q: 22. Which statement is correct about restriction enzyme? They cut methylatedsite They cut…

A: Restriction enzymes are important enzymes in biotechnology that allow the isolation of a particular…

Q: During pcr primers can: become graded by rnases be covslently linked to the template dtrand fall…

A: PCR stands for polymerase chain reaction. It is used to amplify the specific region of gene.

Q: CRISPR AS9 is a: alien weapon to control our minds a eukaryotic gene protein matrix type of immune…

A: What is CRISPR-CAS9 It is a unique technology that helps in the editing of different parts of…

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: Given sequence of EboV strain 1 is CTA TGC AAG CAG TTA and strian 2 is TCA TGT CAG CAA CTA.

Q: you carry out DNA editing using CRISPR whter the editing template DNA has strands labeled with heavy…

A: DNA (Deoxyribonucleic acid) is edited with the help of several molecular tools. CRISPR (Clustered…

Q: • Suppose you perform a PCR that begins with one double-strand of the following DNA template:…

A: Ans: Polymerase Chain Reaction (PCR): The process of in-vitro replication of DNA is referred to as…

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: 103 A (+)RNA v (-)RNA O dsRNA O retrovirus O SSDNA O dsDNA 104 105 10 107 10 10 104 105 100 Per-base…

A: Base mutation The genetic material of all organisms is made up of nitrogenous bases that are further…

Q: Which of the enzymes from the following list wouldyou need to make a cDNA library? What is the…

A: The cDNA is the complementary DNA of the messenger RNA, where the DNA can be synthesized from the…

Q: Which of the following is not part of the genome annotation process for deducing the protein-coding…

A: The process of detecting functional element present in a genome is termed genome annotation. It…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: How many cycles of PCR are needed to obtain 512 amplicons? O 7 0 9 O 6

A: PCR is a revolutionary approach developed by Kary Mullis in the 1980s. PCR is based on the use of…

Q: After being exposed to radioactive, a strand of DNA with the sequence ATTATCTGC has been changed to…

A: Mutations are nothing but change in the nucleotide sequence in the genetic material . It is of…

Q: library contains a collection of DNA clones derived from MRNAS. library contains a collection of DNA…

A: Genomic library is a library which encompasses the entire genome. Genomic Library involves the…

Q: Pcr is an twchnique to amplify: dna rRna mrna protein

Q: Polymerase chain reaction is commonly used in the laboratory for a) reverse transcription Ob) DNA…

A: In biological and medical research centers, The polymerase chain reaction (PCR) is a frequent…

Q: (AKS 8a2, DOK 1) Analyzing DNA with a DNA fingerprint developed by gel electrophoresis allows…

A: Gel electrophoresis is the method of separation of molecules by applying an electric field and using…

Q: In the CRISPR system of bacteria, the spacer is a(n). A) O bacterial gene B) O bacterial enzyme C) O…

Q: The enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy.…

A: DNA cloning is a process in which clones / copies of DNA are formed . DNA sequencing is a technique…

Q: Below are two sequences of a segment of DNA. Normal sequence TAG GTC CÁC Mutated sequence TAG GTC…

A: TRANSVERSION In this mutation involving a transversion i.e. a purine is substituted for a pyrimidine…

Q: What conclusion would you draw if the numbers of bacterial colonies in Figure 18.22 were the same on…

A: Mutations are described as any change in the genetic sequence of an individual. The substances that…

Q: Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome…

A: a. Exome: It is the part of a genome that contains all the exons.b. de novo gene: These are the new…

Q: Which of the following is NOT a vector used in genetic engineering? O A. mosquitos O B. viruses OC.…

A: Foreign DNA is delivered into recipient cells using genetic vectors. Vectors can self-replicate and…

Q: You can introduce precise edits into the genome using Crispr/Cas9 and , O A. ligation O B. homology…

A: Genome editing It is a technology use by scientists to change the sequence of perticular part of…

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: A prokaryotic genome is about 4 million bp in length. About howmany genes would you expect it to…

A: Deoxyribonucleic acid (DNA) is the main constituent of the chromosome. It contains all information…

Q: the target DNA

A: CRISPR: It stands for Clustered Regularly Interspaced Short Palindromic Repeats. These are the…

Q: Basic pRotein coding gene steucture: TF'S ENA-Pol TSS genomic DNA PROmoteRlexon ATG intreon exon…

A: By the process of transcription mRNA is produced from the DNA. This process occurs within the…

Q: The restriction enzymes used in gene-cloning experiments, which generates sticky ends that can .a.…

A: Deoxyribonucleic acid (DNA) is a long molecule. DNA contains the instructions an organism required…

Q: In 1973. Stanley Cohen and Herbert Boyer inserted a gene from an African clawed frog into a…

A: Recombinant DNA technology is the joining together of DNA molecules from two different species.The…

Q: Which of the following steps is NOT involved in gene cloning? Lütfen birini seçin: O a. Transferring…

A: Gene cloning is the technique of isolating and forming copies of gene of interest.

Q: 1) you have a locus in your PCR reaction that is a DNA squence is on the fifth chromosome, is a…

A: Gel electrophoresis is a common laboratory method used for the separation of DNA, RNA, or proteins…

Q: Which of the enzymes from the following list wouldyou need to sequence DNA? What is the function…

A: DNA sequencing is a process in which the sequence of the nitrogenous bases is determined in the…

Q: (AKS 8a2, DOK 1) Analyzing DNA with a DNA fingerprint developed by gel electrophoresis allows…

A: DNA fingerprint is a process that allows identifying paternity by compared among several…

Q: You have completed an in vitro mutagenesis experiment to create an G to Tmutation in the coding…

A: After first being developed by Frederick Sanger and colleagues in 1977, Sanger sequencing became the…

Q: Which area (A., B. C. or D) represents the region important for maintaining the gene of interest…

A: A vector is defined as a DNA molecule which can be used for carrying foreign DNA segment or gene of…

Q: Which of the enzymes from the following list wouldyou need to make a recombinant DNA molecule?…

A: The recombinant DNA is where the two or more DNA molecules are integrated into a vector plasmid to…

Q: 2. You want to clone a specific PCR amplicon. You have determined that the amplicon you want to…

A: pUC57 is a commonly used plasmid cloning vector in E. coli.

Q: You have completed an in vitro mutagenesis experiment to create an G to T mutation in the coding…

A: In molecular biology, sequencing is the most important phenomenon in which the the behaviour and…

Q: It is difficult to use a restriction enzyme that cuts (shown as ) within one of these restriction…

A: Ans- It is difficult to use a restriction enzyme that cuts like the sequence given in option D( *…

Q: Why is CRISPR useful for genome editing? O it can't be used in humans, but it works really well in…

A: Answer:- Option D The gene editing is a recent concept. It allows cutting the DNA sequence at a…

Q: Which of the following mutagens results in the deamination of nitrogenous bases? O nitrous acid base…

A: The amino bases adenine and cytosine lose one amino group when they are oxidised. As a result, in…

Q: A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the…

A: PCR is polymerase chain reaction that amplifies given DNA molecule into many copies of specific DNA…

Q: gene Genetically Engineered Virus Chromosomes Bone manow Figure 15-2 A normal hemoglobin gene is…

A: Dna finger printing is a technique which is used to compare the DNA of two individuals to identify…

Q: Using the DNA sequence Genetically modified TAC CAG ATA CAC TCC organisms (GMOs)- CCT, create the…

A: A mutation is an alteration in the nucleic acid sequence of a gene encoding a protein. Mutations…

Q: Why is the scale of this map in minutes?

A: The genetic map of a chromosome tells the position of different genes.

Q: The accompanying photo shows a sequencing gel from the original study that first sequenced the…

A: Cystic fibrosis is a type of inherited disease that will cause serious damage to the digestive…

Q: Which of the following term is associated with DNA finger printing?a) Hybridomab) Site specific…

A: DNA fingerprinting - DNA fingerprinting is a kind of technique which is used to make or identify the…

Question

Page 6 of 6
Describe the cloning vectors that would be used to clone each of the following DNA fragments:
1000 bp CDNA, 8000 bp eukaryotic gene fragment, 100,000 bp segment of a chromosome.
2leongsib 1olbrns donesas i boau ons vodb worl to slqmsxo ns sbivo1 Sa9 HE

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5
Which of the enzymes from the following list wouldyou need to make a cDNA library? What is the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 19 options: LINE & SINE/Alu sequences LINE sequences & IS elements transposons & LINE sequences transposons & retrotransposons SINE & Alu sequences
The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 40 options: LINE & SINE/Alu sequences LINE sequences & IS elements SINE & Alu sequences transposons & retrotransposons jumping genes & deletors
23. Important elements of a directed evolution experiment (“evolution in a test tube”) for an ATP-binding aptamer include: MARK ALL THAT APPLY. Group of answer choices Mutagenic PCR DpnI restriction enzyme Randomized DNA pool ATP affinity column
Which of the enzymes from the following list wouldyou need to sequence DNA? What is the function ofthose enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase
1) you have a locus in your PCR reaction that is a DNA squence is on the fifth chromosome, is a single copy locus, and has a squcne ID# 818. What is a name according to ISFG nomenclature 2) in electrophoresis system, DNA migartes toward____ which is _____ charged.
13. Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes Group of answer choices Primer Walking Positional Cloning Directional Cloning Chromosome Walking
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’