In details summarize the process of transcription.
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…
Q: What regulates the process of transcription and translation; compare and contrast these processes.
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Know the relationship between exons and protein domains.
A: Introduction: Nucleic acid coding segments found in mRNA are known as exons. Non-coding segments in…
Q: Which is a feature of mRNA processing in eukaryotes? removal of exon sequences addition of a…
A: Processing of mRNA Until introns are removed and the mRNA is considered ready for translation,…
Q: Describe the process of transcription in as much detail as possible using pictures and words…
A: Note- According to the guidelines only one question can be answered at a time. Hence, one question…
Q: In details summarize the process of transcription.
A: Transcription is the process of copying the DNA bases and converted into single-stranded mRNA…
Q: Illustrate a hypothetical genetic code by spelling out the nucleotide codons of a segement of mRNA…
A: Genetic code is the triplet sequence of nucleotides in the gene or mRNA (messenger ribonucleic acid)…
Q: Enumerate the types of RNA and identify the function of each type.
A: Ribonucleic acid (RNA) is a polymeric molecule that plays an important role in gene coding,…
Q: write the difference between DNA and RNA. Also compare the function of DNA and RNA . ( please…
A: The differences between the DNA and RNA are given below.
Q: Explain how a single base change in a gene could lead to premature termination translation of mRNA…
A: Premature termination of translation refers to the termination of protein synthesis before the…
Q: Identify three ways transcription is different from replication.
A: Transcription: The formation of RNA take place from the template strand DNA. It occurs to form RNA…
Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: Explain the process of translation.
A: mRNA is used to synthesise proteins during the translation process, which occurs during the process…
Q: Explain how the genetic code is used in the expression of a gene.
A: The information saved in the genetic material (DNA or RNA) that is converted into RNA to form…
Q: Discuss the genetic code, and explain how it works withdifferent types of RNA to make a protein.
A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…
Q: illustrates how RNA splicing works?
A: The central dogma involves the transfer of information from DNA to RNA and then to the proteins.…
Q: Transcription of genes starts at regions of the genome called
A: Transcription begins when an RNA polymerase binds to a so-called promoter sequence on the DNA…
Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.
A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…
Q: Examine the diagram below. At which times is translation but occurring? Production of a Particular…
A: The translation of the information contained in a mRNA (messenger ribonucleic acid) into an amino…
Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…
A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.
Q: Illustrate how a change in chromosome organization may affect the activity of a gene.
A: Chromosomes are built up of nucleosomes, which are subunits of a DNA-protein structure termed…
Q: Diagram a section of DNA being transcribed. Give the various names for the two strands of DNA.
A: Transcription is the process of synthesizing of single-stranded mRNA strand from the double-helical…
Q: _____________ are molecular machines that excise introns from pre-mRNA and then join exons together.
A: In eukaryotes, the RNA transcript that is formed by transcribing a DNA molecule is termed pre-mRNA…
Q: Briefly describe the events in translation.
A: The translation is one of the defined processes of the cell cycle. It is the last step in fact and…
Q: Write a short note on replication of DNA.
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: Explain about transcription unit.
A:
Q: Explain the process of TRANSLATION
A: DNA is the nucleic acid that stores genetic information.
Q: Write down some function of Mrna?
A: mRNA stands for messenger RNA. The process of the formation of messenger RNA from the DNA is called…
Q: Synthesize mRNA strands from the DNA templates
A: The DNA consists of two strand template strand and complementary strand. The molecule of DNA…
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…
Q: Explain the steps in DNA Translation
A: The translation is the decoding of the genetic code found within a messenger RNA (mRNA) molecule to…
Q: Describe the role of stop codons in the termination of protein synthesis.
A: Protein synthesis is a biological mechanism that occurs within cells to compensate for the loss of…
Q: Compare and contrast the process of transcription and translation in prokaryotes then describe…
A: Transcription is a process of formation of transcript (mRNA) from DNA. It takes place through usual…
Q: The process of transcription produces
A: Central dogma is a process that explains the flow of genetic information in a cell comprising…
Q: Compare the DNA transcription process in bacteria and eukaryotes, analyze the similarities and…
A: DNA transcription process in bacteria- At first a segment of bacterial DNA is copied into a newly…
Q: Explain the roles of mRNA, tRNA, and rRNA in translation.
A: Ribonucleic acids (RNAs) are one of the important components of cells. It is involved in protein…
Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…
A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…
Q: Recount the participants and steps in translation (protein synthesis).
A: Translation, or protein synthesis, is the process by which the code from DNA, after being converted…
Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.
A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.
Q: Indicate the differences between the coding and non-protein coding RNA.* Write the answer.
A: The information for synthesis of functional proteins is stored in DNA (Deoxyribonucleic acid). A…
Q: Examine the diagram below. At which times is transcription and not translation occurring? Production…
A: The phenotypic characteristics of an organism are controlled and regulated by its proteome, and each…
Q: Discuss DNA to RNA transcription in a simple way (
A: Definition : Process of copying a segment of DNA into RNA is known as Transcription. In simple,…
Q: Describe the genetic code, and explain how DNA codes for specific amino acid sequences?
A: Introduction: Genetic code is the sequence of amino acids during the synthesis of protein. any…
Q: Discuss the relationship between RNA and the Genetic Code and what that means for protein synthesis.
A: Protein synthesis is a biological process in which cell makes protein and it occurs through two…
Q: explain Transcription: From DNA to RNA
A: The study of macromolecules and their mechanisms in living organisms is called molecular biology.…
Q: Explain the process of mRNA to DNA translation.
A: Translation is the process of decoding the mRNA and building a polypeptide chain by the information…
- In details summarize the process of transcription.
- Explain how do you sequence the DNA
Step by step
Solved in 4 steps
- Explain the steps in DNA Transcription.How are nucleotides formed? In details summarize the process of DNA replication. In details summarize the process of Translation and post translation process. In details summarize the process of transcription. Explain how do you sequence the DNAExplain how the DNA code is used to create a protein.
