In microorganisms, several kinds of recombination are known to occur. The most common form is general recombination, which usually involves a reciprocal exchange of DNA between a pair of DNA sequences. Illustrate and discuss THREE (3) mechanism of gene transfer in bacteria.

In microorganisms, several kinds of recombination are known to occur. The most common form is general recombination, which usually involves a reciprocal exchange of DNA between a pair of DNA sequences. Illustrate and discuss THREE (3) mechanism of gene transfer in bacteria.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 1TYU: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain...

See similar textbooks

Related questions

Q: For bacteria living in a rapidly changing environment, would a population of bacteria capable of…

A: In Bacteria Conjugation is dependent upon thetra genes found in 'conjugative' plasmids, which, among…

Q: When the interrupted mating technique was used with five different strains of Hfr bacteria, the…

A: An interrupted mating technique is a method of determining gene sequence by interrupting the process…

Q: In a conjugation experiment, what is meant by the time of entry? How is the time of entry determined…

A: Conjugation is a method of recombination in bacteria. This occurs by direct connection between cells…

Q: When the interrupted mating technique was used withfive different strains of Hfr bacteria, the…

A: Bacteria and other prokaryotes do not have a nucleus. Their genome is located in the cytoplasm of…

Q: A series of Hfr strains that have genotype m+ n+ o+ p+ q+ r+ are mixed with an F− strain that has…

A: High frequency chromosomes, commonly known as Hfr chromosomes are those that have a conjugative…

Q: With regard to the repair of double-strand breaks, what are the advantages and disadvantages of…

A: The advantages of homologous recombination repair (HRR): In this mechanism, sister chromatids are…

Q: What is the name of the process in which a single strand of DNA disrupts a homologous dsDNA molecule…

A: primers the short, single-stranded nucleotide sequence that is used in the DNA synthesis process.…

Q: How does homologous recombination differ from site-specific recombination?

A: Recombination is a process by which pieces of DNA are broken and recombined to produce new…

Q: The amount of DNA in eukaryotic cells is significantly greater than in prokaryotes. With this in…

A: The prokaryote has bidirectional replication whereas the eukaryote has unidirectional replication.

Q: Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements…

A: Transposons are called jumping genes they change their position within a Genome.

Q: A group of genetics students mix two auxotrophic strains of bacteria: one is leu+ trp+ his− met− and…

A: Bacteria are a group of prokaryotic microscopic single celled organisms. They live in diverse…

Q: Consider the following types of cells: F+, F-, Hfr, and F’ cells. Which of these four types of cells…

Q: In a conjugation experiment, How is the time of entry determined experimentally?

A: Bacterial conjugation is the transmission of bacterial genes via direct contact or by forming a…

Q: In the homologous recombination in bacteria, which of the following enzymes has a nuclease activity…

A: Recombination is the process that creates new gene combinations.

Q: Three different Hfr donor strains are mixed with separate samples of an F strain, and the following…

A: Interrupted mating experiment is a technique in which donor bacteria Hfr strain is used to transfer…

Q: Describe the mechanisms of horizontal gene transfer in bacteria, describing the manner in which the…

A: Horizontal gene transfer, or the process of exchanging genetic material between neighboring…

Q: list other biological examples in which specific (bacteriophage specificity) protein interactions…

A: Protein-protein interaction (PPI) is the physical contact or the interaction established between two…

Q: In gene mapping using generalized transduction, bacterial genes that are cotransduced are a. far…

A: Transduction is a process used to map the bacterial genes. The transduction is of two types,…

Q: General recombination occurs in bacteria where it is involved in several types of intermicrobial DNA…

A: Genetic refers to relating to the genetic material. The genetic material of a cell is the DNA…

Q: What are some of the enzymes taking part in recombination in E. coli and what roles do they play?

A: Following are some of the enzymes that taking part in the recombination in E coli

Q: In recombination studies of the rII locus in phage T4, what is the significance of the value…

A: Seymour Benzer developed an experimental system around 1950s for analyzing various subparts of a…

Q: Origins of transfer can be located in many different locations, and their direction of transfer can…

A: Transfer of genes in prokaryotes occurs through horizontal transfer mechanisms such as transduction,…

Q: Transfer of a donor chromosome fragment by a bacteriophage is defined as

A: Ans- Transduction Transformation is a type of genetic transfer that involves a bacterium taking up…

Q: In what ways does conjugation create bacterial cells that are at least partially diploid? Is this a…

A: Conjugation is the process of transfer of genetic material from one bacterium to another by direct…

Q: Austin Taylor and Edward Adelberg isolated some new strains of Hfr cells that they then used to map…

A: Transfer of genes in prokaryotes occurs through horizontal transfer mechanisms such as transduction,…

Q: Based on the images attached, what does the similarity in the sequences tell you about the ermB gene…

A: A cladogram is a branching tree diagram that depicts a phylogeny estimation of the evolutionary…

Q: Among the mechanisms of gene transfer in bacteria, which one is capable of transferring the largest…

A: There are three methods of gene transfer in bacteria.TransformationTransductionConjugation

Q: With regard to the repair of double-strand breaks, what are the advantages and disadvantages of…

A: Double strand breaks is a mechanism to repair any break in the double stranded DNA molecule. The…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: Transfer of genes in prokaryotes occurs through horizontal transfer mechanisms such as transduction,…

Q: In threonine selected marker number of co-transformation rate is Met 2%-Gly 60%- Trp 10%. In…

A: Introduction: When transformation of two or more genes occur together simultaneously then this…

Q: Categorize the following as being associated with transformation, conjugation, or transduction. Note…

A: There are three principal methods of genetic transfer between bacteria. Transformation deals with…

Q: DNA from a strain of Bacillus subtilis with genotype a+ b+ c+ d+ e+ is used to transform a strain…

A: Co transformation means that the two genes are transformed simultaneously. Is two genes are co…

Q: In addition to correcting DNA mismatches, themismatch repair system functions to prevent…

A: Mutations are usually defined that they are supped to refer to changes or alterations that occur in…

Q: What is one of the end results of site-specific recombination? Diagram your answer and answer in 1-2…

A: Site-specific recombination moves nucleotide sequences are called mobile genetic elements and they…

Q: What is meant by the term site-specific recombination as used in identifying the processes that lead…

A: Phages cannot reproduce on their own as they use their biological machinery in the host cell for…

Q: Conjugation differs from other means of horizontal gene transfer between bacteria cells because…

A: Horizontal gene transfer is the movement of genetic information between unicellular and…

Q: With respect to F+ and F- bacterial matings, answer the following questions: (a) How was it…

A: It is located majorly inside the nucleus. It can exist in three different forms based on the…

Q: Using a named example, discuss the advantages of using E. coli to produce recombinant proteins.

A: Recombinant DNA technology defines the artificial manipualtion of the genetic material to create the…

Q: You co-culture the following bacterial strains: an Hfr prototroph and an F- auxotroph for the genes…

A: Introduction: HFr is a high-frequency recombination bacterial cell whose sex plasmid is attached to…

Q: You isolated two bacteria from soil that you assumed were different species since they have…

A: Bacteria are microscopic, single-celled organisms that are present in their millions, in every…

Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…

A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…

Q: Describe how to select recombinant clones if a foreign DNA is inserted into the polylinker site of…

A: Introuction- pUC18 is a 2686 bps long plasmid vector which contains pMB1 as origin of replication…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: Horizontal gene transfer, also known as lateral gene transfer, is a process in which one bacterium…

Q: For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why…

A: Bacteria employs three ways for transferring the DNA :- 1. Conjugation 2. Transformation 3.…

Q: Microbiology, Horizontal Gene Transfer Describe the role of recombination in gene transfer: which…

A: Genetic recombination takes place when hereditary material is swapped between two dissimilar…

Q: In a conjugation experiment, we used two strains: Hfr: streptomycin sensitive and F-: auxotrophic…

A: Bacterial conjugation is a process through which the DNA is transferred from the living cell into…

Concept explainers

Wound infections

A wound is damaged or breaks in the surface of the skin. The wound is divided into two types, they are acute wound that includes minor cuts, laceration, bites, etc, and chronic wounds that can become slow to heal including ulcers on the legs and feet. Redness, pain, and swelling are signs of a wound.

Question

Kindly answer this question

1.
In microorganisms, several kinds of recombination are known to occur. The
most common form is general recombination, which usually involves a
reciprocal exchange of DNA between a pair of DNA sequences. Illustrate and
discuss THREE (3) mechanism of gene transfer in bacteria.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
17. Which of the following is not a process to introduce a DNA molecule into a bacterial cell. a) Transformation b) Transcription c) Transduction d)Conjugation
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain sequences occur. Why do you think these enzymes do not chop up the bacterial chromosome, which is exposed to the enzymes in the cytoplasm?
16) Bacterial DNA replication is said to be: a) Linear b) curvilinear c) circular d) exponential e) hyperbolic 17) Cytokinesis in bacteria takes place through a process called: a) Cleavage b) septation c) cell plate formation d) molting e) cytolysis 18) The time in minutes at a specific temperature needed to kill a population of cells or spores is called: a) Z value b) K value c) Q10 d) D value e) F value19) If patients are allergic to penicillin, then you prescribe __ as an alternative: a) Tetracycline b) Cephalosporin c) Erythromycin d) Sulfonamides e) Fluoroquinolones 20) Biological control of Salmonella is by using: a) E. Coli (ETEC Strain) b) Shigella c) Bdellovibrio d) Plasmodium e) Spirillum
1. Write if the statement is true and modify the statement with the correct answer if its false a.White colonies represent those bacteria that do not express the genes for beta-galactosidase because restriction enzymes have cut the gene and ligase have not repaired the break b.Antibiotic resistance genes in bacterial transformation are used as marker genes because of ease of detection of transformants. c. Bacterial transformation simply means the insertion of a recombinant plasmid into a bacterial cell.
4. In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain.a. How would you know that gene transfer is takingplace?b. To determine if the gene transfer is transformationor transduction, you treat the mixed culture of cellswith DNase. Why would this treatment distinguishbetween these two modes of gene transfer? Describethe results predicted if the gene transfer is transformation versus transduction.c. To determine if the gene transfer involves transformation, conjugation, or transduction, you separatethe ampicillin-resistant and ampicillin-sensitivestrains by a membrane with pores that are smallerthan the size of a bacterium, but larger than thesizes of bacteriophage or DNA fragments. If genetransfer is still observed, what mechanisms arepossibly involved and which are excluded?
1- A genetic analysis of a bacterium reveals the presence of viral DNA. The most probable way this happened was through (a)mutation (b) conjugation (c)transduction (d)transposons (e)transformation 2- Which statemere is tobe regarding GEMC (a)typical cloning vectors involbe plasmids and viruses (b)eukaryotic genes may only be introduced and expressed in eukaryotic microbes such as yeasts (c)horizontal gene transfer methods may be manipulated to introduce new genes (d) expressions of introduced genes can be monitored through the use of marker genes. (e)it is possible for multiple genes may be added to microbes from other sources . plz give answer for both questions asap please
2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove several kbof DNA from the genome. This method is possibleeven in cells defective in homologous recombination,as long as the cells can still perform nonhomologousend-joining (NHEJ). a. How could researchers make such deletions?
4. Bacterial transformation and bacteriophage labelingexperiments proved that DNA was the hereditary material in bacteria and in DNA-containing viruses.Some viruses do not contain DNA but have RNA inside the phage particle. An example is the tobaccomosaic virus (TMV) that infects tobacco plants, causing lesions in the leaves.Two different variants of TMV exist that havedifferent forms of a particular protein in the virus particle that can be distinguished. It is possible to reconstitute TMV in vitro (in the test tube) by mixing purifiedproteins and RNA. The reconstituted virus can then beused to infect the host plant cells and produce a newgeneration of viruses. Design an experiment to showthat RNA, rather than protein, acts as the hereditarymaterial in TMV.