Strain Order of Gene Transfer tort azi' leut thr mer sa gul" lac* pro leut azi ton prot lact galt stf mner thrt lac* gal* st ma* thr* leu azi Ion" pro leu thr met st gal" lac" pro* ton" azi ton pro* lac" gal ai met* thr" leu azi mer* ar gal" lac" pro* ton azī leu thr*

Strain Order of Gene Transfer tort azi' leut thr mer sa gul" lac* pro leut azi ton prot lact galt stf mner thrt lac* gal* st ma* thr* leu azi Ion" pro leu thr met st gal" lac" pro* ton" azi ton pro* lac" gal ai met* thr" leu azi mer* ar gal" lac" pro* ton azī leu thr*

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Related questions

Q: What is an exconjugant? How do you think that exconjugants were obtained? (It might include genes…

A: Answer: Introduction: Conjugation is the process of transfer of DNA from one bacterium to other by…

Q: The figure below shows a partial chromosome map of an E. coli Hfr strain. Each mark = 10 minutes…

A: Given: A partial chromosome map of an E. coli Hfr strain. Each mark = 10 minutes between…

Q: If locus F is 11 cMorgans from locus H and locus H is 44 cMorgans from locus E, determine the…

A: Locus is the position of the genes on the chromosomes. The distance between two genes is measured in…

Q: In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X…

A: The High-Frequency Recombination Strains(Hfr)- When the F+ chromosome combines with F plasmid . It…

Q: What is the role of the origin of transfer during F+- and Hfr-mediated conjugation? What is the…

A: Conjugation is a process of transfer of genetic material between two bacteria. This transfer can…

Q: In a conjugation experiment, what is meant by the time of entry? How is the time of entry determined…

A: Conjugation is a method of recombination in bacteria. This occurs by direct connection between cells…

Q: A series of Hfr strains that have genotype m+ n+ o+ p+ q+ r+ are mixed with an F− strain that has…

A: High frequency chromosomes, commonly known as Hfr chromosomes are those that have a conjugative…

Q: BACTERIA STRAIN A IS AUXOTROPHIC FOR METHIONINE AND STRAIN B IS AUXOTROPHIC FOR LEUCINE. A. WILL…

A: Auxotrophic strains lack the property of synthesising the growth factors required for their proper…

Q: For bacteria that are F+, Hfr, F', and F- answer the following. a. Describe the state of the F…

A: a)The F factor is called “Fertility factor,” which is present on the F episome. This factor…

Q: In an Hfr × F− conjugation, genes can be mapped roughlyby the time at which different alleles from…

A: Conjugation is the process of genetic material transfer between two bacterial cells through direct…

Q: In Escherichia coli, four different Hfr strains, derived from the same F strains, were mated with F-…

Q: Let’s suppose a new strain of P1 phage has been identified thatpackages larger pieces of the E. coli…

A: When two genes are present close to each other in a chromosome, the bacteriophages can package the…

Q: DNA from a strain of Bacillus subtilis with genotype a + b + c + d + e + is used to transform a…

A: Introduction :- The basic physical and functional unit of heredity is the gene. DNA is the material…

Q: A group of genetics students mix two auxotrophic strains of bacteria: one is leu+ trp+ his− met− and…

A: Bacteria are a group of prokaryotic microscopic single celled organisms. They live in diverse…

Q: help

A: The cis acting factors are present in the vicinty of a gene. The trans acting factors are produced…

Q: Crosses are carried out between a bacterial F- strain and three different Hfr strains. In these…

A: The interrupted mating experiment is given in the question. It is used to find the order of genes…

Q: Why would it have been possible to utilize N14 in the original bacteria and only allow growing…

A: To build new F1 bacteria one strand from parent strain and one from the new N15 strain is required…

Q: In your laboratory, you have an F − strain of E. coli that is resistant to streptomycin and is…

A: Conjugation is the transfer of genetic material from one bacterium to another bacterium. Here, a…

Q: You need to determine where your gene of interest lies on the bacterial chromosome. In order to…

A: Bacteria strain with Leu-bio-pro- are mixed with wild type Hfr strain . Also , pro gene is…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: Genetic material is transferred between bacterial cells by direct cell-to-cell contact or by a…

Q: Three different Hfr strains, derived from the same F* strains (H), were mated with F strains…

Q: An Hfr strain that is leuA+ and thiL+ was mixed with a strain thatis leuA− and thiL−. In the data…

A: Transfer of genes in prokaryotes occurs through horizontal transfer mechanisms such as transduction,…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: On the basis of the given information, it can easily be predicted that it explains the…

Q: Strain W Strain X Strain Y Strain V Strain Z Under these conditions, rank cterial strains from most…

A: In competitive dominance hierarchy diagrams, the arrow suggests that the pointed species is more…

Q: In the Hershey–Chase experiment, the radioactive label 32P was present inside bacterial cells (i.e.,…

A: DNA is an organic molecule that transmits information from generation to generation. Several…

Q: Describe the experiment done by Frederick Griffith in 1928, where the non-lethal (rough) strain of…

A: Frederick Griffith was a British bacteriologist.He was a physician, pathologist and a…

Q: Construct a circular chromosome map and show the direction of the transfer and various locations of…

A: Bacterial conjugation is the transfer of genetic material (plasmid) from one bacteria to another in…

Q: . In an interrupted-conjugation experiment in E. coli, thepro gene enters after the thi gene. A pro+…

A: Part A. The genotypes of the two types of cultures are: pro+ thi- They grow only on the media that…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: Transfer of genes in prokaryotes occurs through horizontal transfer mechanisms such as transduction,…

Q: In this experiment, _____ plates were used to differentiate between red and white diploid yeast…

A: Yeast cells are eukaryotic, single-celled microorganisms that belong to the fungus kingdom. They are…

Q: What is horizontal gene transfer? What are the three mechanisms for this to occur in bacteria? What…

A: 1. The non-sexual flow of genetic information between genomes is known as horizontal gene transfer…

Q: In the transformation experiment by Griffith, two strains of an organism was injected into a mouse…

A: Frederick Griffith was the man who performed the transformation principle on Streptococcus…

Q: Using the figure above of Griffith's experiment, the hypothesis rewritten to follow proper…

A: Griffith’s experiment involved the use of two strains of pneumococcus (Streptococcus pneumoniae), a…

Q: In a generalized-transduction experiment, phages arecollected from an E. coli donor strain of…

A: Part A. In the question given that - "initially the treated recipient populations placed on a…

Q: The map below was constructed using information from an interrupted mating experiment. Str# refers…

A: The gene transformation interrupted mating experiment is performed for the identification of the…

Q: Both the isolation buffer and assay buffer that was used in isolation of mitochondria contained 0.3M…

A: Mitochondria is a double membrane organelle with a rod like shape. It produces chemical energy in…

Q: A prototrophic strain (his" arg" lac') was used as a donor to transform an auxotrophic strain (his…

A: Minimal media is the one which contains only nutrients essential for the growth of bacteria. There…

Q: An Hfr strain is used to map three genes in an interrupted mating experiment. The cross is…

A: rifamycin is used to confirm transformed bacteria as the Hfr has rif+ gene

Q: With respect to F+ and F- bacterial matings, answer the following questions: (a) How was it…

A: It is located majorly inside the nucleus. It can exist in three different forms based on the…

Q: Three different Hfr strains, derived from the same F* strains (H), were mated with F strains…

A: The interrupted mating experiment is performed to identify the gene order of bacterial plasmid.…

Q: In the Meselson experiment, would it have been possible to utilize N14 in the original bacteria and…

A: Meselson and Stahl experiment proved that DNA replication is semiconservative in nature.

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Q. Three Hfr strains derived from the same E. Coli original strain are allowed to conjugate with an…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: Horizontal gene transfer, also known as lateral gene transfer, is a process in which one bacterium…

Q: . Figure 1-7 shows a simplified pathway for argininesynthesis in Neurospora. Suppose you have a…

A: The gene that is likely to be mutant or missing when the strain makes citrulline but not arginine…

Q: In a conjugation experiment, we used two strains: Hfr: streptomycin sensitive and F-: auxotrophic…

A: Bacterial conjugation is a process through which the DNA is transferred from the living cell into…

Concept explainers

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.

Question

Origins of transfer can be located in many different locations, and their direction of transfer can be clockwise or counterclockwise. Let’s suppose a researcher conjugated six different Hfr strains that were
thr⁺ leu⁺ ton^s str^r azi^s lac⁺ gal⁺ pro⁺ met⁺ to an F⁻ strain that was
thr⁻ leu⁻ ton^r str^s azi^r lac⁻ gal⁻ pro⁻ met⁻, and obtained the following
results:
Draw a circular map of the E. coli chromosome that shows the
locations and orientations of the origins of transfer in these six
Hfr strains.

Strain
Order of Gene Transfer
tort azi' leut thr mer sa gul" lac* pro
leut azi ton prot lact galt stf mner thrt
lac* gal* st ma* thr* leu azi Ion" pro
leu thr met st gal" lac" pro* ton" azi
ton pro* lac" gal ai met* thr" leu azi
mer* ar gal" lac" pro* ton azī leu thr*

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoter
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 3 EboV Strain 3 (Circle the mutated bases) CCA TAT AAG CAG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
Write the base sequence of the DNA template from whichthis RNA sequence was derived: GUAUCAAUGAACUUG.How many amino acids are coded for in this sequence?
DNA ladder is attached (the picture shows HindIII as H, EcoRI as E, BamHI as B). Now, determine the size of fragments created by EcoRI and BamHI. In the graph attached there is the fragment size of HindIII. HindIII EcoRI BamHI Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) Migration Distance (mm) Fragment Size (bp) 23455 11985 7430 4375 2150 1850
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 2 EboV Strain 2 (Circle the mutated bases) TCA TGT CAG CAA CTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.
gene cloning of amplified gene with enzmes
ques 1 . A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained: Enzyme Fragment size (kb). EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 EcoRI+Hpall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 a. Is the original molecule linear or circular? b. Draw a map of restriction sites, showing distances between sites, that is consistent with the data presented. ques 2. You have double-stranded DNA that you radioactively label at the 5' ends. Digestion of this molecule with either EcoRI or BamHI yields the following fragments. The numbers are in kilobases (kb) and an asterisk Indicates the fragments that are unlabled EcoRI: 2.8, 4:6, 6.2*, 7.4, 8.0* BamHI: 6.0%, 10.0", 13.0 IF unlabeled DNA is digested with both enzymes simultaneously, the fragments 1.0, 2.0, 2.8, 3.6, 6.0, 6.2,7.4. What is the restriction map for the two enzymes?