Crick's Central Dogma states that there is a unidirectional flow of genetic information DNA ---> RNA -----> Protein Explain why this may not always be the case. (Describe a scenario in which movement may occur in the opposite direction).

Crick's Central Dogma states that there is a unidirectional flow of genetic information DNA ---> RNA -----> Protein Explain why this may not always be the case. (Describe a scenario in which movement may occur in the opposite direction).

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons. Eukaryotic genomes are much…

Q: What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'?…

A: As per our guidelines we are supposed to answer only 3 sub parts.

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: You are a genetic engineer that is working on transcriptional regulation in living organisms. In…

A: Genetic engineering is the use of genetic knowledge to artificially manipulate genes: It is one of…

Q: Human Genome Project In 2003, the Human Genome Project was successfully completed, determining the…

A: A gene patent is a government-granted exclusive right to a particular sequence of DNA (a gene) to…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which RNA transcript is formed from DNA. Various type of RNA are…

Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Many aspects of gene function can be nicely explained with the one- gene-one-enzyme hypothesis,…

A: Genes are a set of instructions that determine what the organism is like, its appearance, how it…

Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…

A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: A eukaryotic gene contains 14 exons. Most of the transcripts from this gene contain all 14 exons,…

A: Introduction : Different combinations of exons of same gene when combined and produce different…

Q: What is the difference between transcription and translation during the central dogma of molecular…

A: The gene expression is divided by mainly two steps that are transcription and translation. Together…

Q: The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which…

A: In Sanger sequencing, the objective is to analyze the sequence of a given strand of DNA. To obtain…

Q: CpG is an epigenetic term that means: Select one: a. The binding of cytosine with the following…

A: We know that, DNA is the genetic material of almost all living organisms. It is made up of monomers…

Q: CpG is an epigenetic term which means: Select one: a. The binding of cytosine with the following…

A: DNA is the genetic material of almost all living organisms. It is made up of monomers of…

Q: After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into…

A: a) By preparing a probe using the actin amino acid sequence or using the actin gene sequence known…

Q: Sometimes, cDNAs turn out to be “chimeras”; that is, fusions of DNA copies of two different mRNAs…

A: c dna is complementary dna.

Q: A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is…

A: Any alteration occurring in the DNA sequence of an organism is known as mutation.

Q: Human Genome Project In 2003, the Human Genome Project was successfully completed, determining the…

A: Patency can be defined as the term used for the proper authorisation or consent of a particular…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Splicing The removal of introns (non coding part of gene) from pre mature RNA.

Q: Part of the protein-coding region in a gene has the base sequence 3-…

A: Adenine (A), cytosine (C), guanine (G), and thymine (T) are the four nucleotides that makeup DNA…

Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…

A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…

Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…

A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

Q: An important validation of the genetic code occurred when George Streisinger determined the amino…

A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…

Q: You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the…

A: Definition Mutations are changes in DNA sequence. it can result from DNA copying mistakes , made…

Q: Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: A protein has the following amino acid sequence:…

A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…

Q: Describes a method known as Western blotting that can be used to detect a polypeptide that is…

A: Western blotting is a technique that is used to detect a specific protein molecule from the mixture…

Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…

A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…

Q: u have assembled a new prokaryotic genome and are annotating the genes. If you were to search for…

A: Genome Annotation is a multidisciplinary process that includes genetic protein-coding prediction, as…

Q: You are interested in a eukaryotic protein involved in immunity, and you are attempting to express…

A: The question is related to the presence of introns in eukaryotic genome and its absence in…

Q: central dogma of molecular biology describe the flow of information in the cell.There are also…

A: Central dogma is invented by fransic Crick in 1958. Which explains the flow of genetic information.…

Q: Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up…

A: Answer. The majority of eukaryotic genes contain non-coding DNA. The genes tend to have a split…

Q: You are interested in finding out the function of a particular gene in the mouse genome. You have…

A: There are multiple ways to have a distinct character for the gene expression and function. And the…

Q: Part A) In your own words describe what happens in transcription and translation Include which…

A: DNA(Deoxyribonucleic acid) is defined as type of double helical molecule composed of two…

Q: In the genetic code, both AAU and AAC code for asparagine. For this reason, the code is said to be…

A: Most of the amino acids are encoded by two or codons, which shows nonambiguity, and that code is…

Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…

A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…

Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Huntington’s disease is an inherited neurological ailment with a variable age of onset. A protein…

A: Huntington's disease is a neurodegenerative disorder. The repetition of a CAG trinucleotide causes…

Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: How might a single base substitution in the sequence of a gene affect the amino acid sequence of a…

Q: Which of the following statements is TRUE? Group of answer choices The human DNA is single-stranded…

A: DNA is called deoxyribonucleic acids. DNA serves as the genetic material for most organisms present…

Q: A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important…

A: Gene cloning is the process by which we can develop a cloned gene in molecular biotechnology.

Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…

A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…

Q: The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?

A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…

Q: An important validation of the genetic code occurred when George Streisinger determined the amino…

A: The genetic code is the set of rules by which information encoded in genetic material is translated…

Q: A protein has the following amino acid sequence:…

A: Amino acids- Amino acids are organic compounds that combine to form proteins. Amino acids and…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Crick's Central Dogma states that there is a unidirectional flow of genetic information

DNA ---> RNA -----> Protein

Explain why this may not always be the case. (Describe a scenario in which movement may occur in the opposite direction).

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In your own words, What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the code’s Universality? Degeneracy?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid sequences that have been left blank. DNA______ ______ ______ ______ ______ ______ ______ ______ ______ mRNA A U G A C U A G C U G G G G G U A U U A C U U U U A G AA______ ______ ______ ______ ______ ______ ______ ______ ______
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'