A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine. The DNA code for the amino acid sequence of this unknown enzyme is a. GAC CGA TTC TTA b. GAT CGC TTT ATA c. GAA CGG TAC ATC d. GAG CGU UUU AUG

A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine. The DNA code for the amino acid sequence of this unknown enzyme is a. GAC CGA TTC TTA b. GAT CGC TTT ATA c. GAA CGG TAC ATC d. GAG CGU UUU AUG

Name: A portion of an unknown enzyme has the amino acid sequence leucine – a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A portion of an unknown enzyme has the amino acid sequence leucine – alanine – lysine – tyrosine.The DNA code for the amino acid sequence of this unknown enzyme isa.GAC CGA TTC TTAb.GAT CGC TTT ATAc.GAA CGG TAC ATCd.GAG CGU UUU AUG

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAU
Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result. a. Leu → Gln b. Phe → Ser c. Phe → Ile d. Pro → Ala e. Asn → Lys f. Ile → Asn
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
I’m supposed to translate tRNA into amino acids for each codon of the previous question and state what the amino acid chains become. For example: AUG AAA CGC CCA....
A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate – lysine. The DNA code for the amino acid sequence of this unknown enzyme is Select one: a. UCG AAA CUC UUU b. AGT AAG GTT TTC c. AGA AAA CAA ATA d. AGC AAG CTC TTC
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use the codon chart provided above) a. Met Ile Ser b. Cys His Ala c. Gly Ala Thr d. Tyr Trp Val
If a strand of DNA is GAG CGT CTA, what is the sequence of amino acids that will be produced? (use the codon chart provided above) a. Leu Ala Asp b. Ser His Lys c. Gly Leu Cys d. Ile Met Thr
The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA have led to the following protein sequences. In each case, provide a specific explanation of the mutation or mutations that could have occurred. a. Met – Pro – Lys – His – Ser – Ser ... b. Met – Thr c. Met – Thr – Lys – Gln – Leu – Phe ...
The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries the information to make aregion of a polypeptide with the amino acid sequence, methionineglycine-leucine-serine. What would be the consequences if a mutationchanged the second cytosine (C) in this sequence to an adenine (A)?
The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which nucleotides can be changed without modifying the amino acid sequence that will result after translation?
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT