When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand and mRNA codon? O DNA template is 3'-UGA-5. MRNA codon is 5'-ACT-3' O DNA template is 5'-ACU-3'. MRNA codon is 3'-TGA-5'. O DNA template is 3'-ACU-5'. MRNA codon is 5'-TGA-3' O DNA template is 3'-TGA-5'. mRNA codon is 5'-ACU-3'

When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand and mRNA codon? O DNA template is 3'-UGA-5. MRNA codon is 5'-ACT-3' O DNA template is 5'-ACU-3'. MRNA codon is 3'-TGA-5'. O DNA template is 3'-ACU-5'. MRNA codon is 5'-TGA-3' O DNA template is 3'-TGA-5'. mRNA codon is 5'-ACU-3'

Name: When given the DNA message sequence, 5'-ACT-3', what wouldbe the corr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: When given the DNA message sequence, 5'-ACT-3', what wouldbe the corresponding DNA template strand and MRNA codon?O DNA template is 3'-UGA-5. MRNA codon is 5'-ACT-3'O DNA template is 5'-ACU-3'. MRNA codon is 3'-TGA-5'.O DNA template is 3'-ACU-5'. mR

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
What is the amino acid sequence of the peptide that would be synthesized after transcription and translation of the following piece of template strand DNA? 5' 3' codon translations _________________________ codon amino acid T C A T G C G C A A C A AGU Ser ACG Thr CGU Arg UGU Cys UGC Cys GCA Ala UGA stop
Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? A. 5’-AGCGTC-3’ 3’-AGCTAG-5’ 5’-GACGCT-3’ 3’-GATCGA-5’ 5’-UCGAUC-3’ Which mRNA strand is transcribed from the above template DNA strand (the original)? 5’-GAUCGA-3’ 3’-CUGCGA-5’ 5’-CUAGCU-3’ 3’-TCGATG-5’ 5’-AGUGUC-3’ Which tRNA anticodon is complementary to the first mRNA codon (above)? 5’-GAU-3’ 3’-UAC-5’ 5’-AGC-3’ 3’-CGU-5’ 5’-GCU-3’
If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand? 5’ACCGATTACGATTACG3’ If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA? 5’ACCGATTACGATTACG3’ In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific. Unique DNA characteristics Similar characteristics Unique RNA characteristics
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’ 5’-CAUCUG-3’ 3’-CUGCAU-5’ 5’-AUCGAC-3’ 3’-GACGUA-5’ Which tRNA strand is complementary to the first codon in the above mRNA strand? 3’-GAC-5’ 5’-AUG-3’ 3’-CAU-5’ 5’-CAU-3’ 3’-AUG-5’ Which of the following amino acids is coded for by the above tRNA molecule (in a typical eubacterial cell like E. coli)? methionine N-formylmethionine threonine phenylalanine tyrosine
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?