MAKE CONNECTIONS How is ligand binding similarto the process of allosteric regulation of enzymes?(See Figure 8.20.)

Q: Draw every step involved in the chemical synthesis of the dinucleotide (5')CG(3'). Show molecular…

A: The nucleic acid is a macromolecule that is found in all living organisms and the DNA is a class of…

Q: Channel proteins used for the bulk passage of water molecules across the cell membrane?

A:

Q: Briefly outline the roles of ribosome-associated chaperones, hsp70, hsp90, and chaperonins in…

A: Protein folding is the physical process by which a protein chain acquires its native…

Q: regulation of gene expression.

A: Operon is operating units which can be defined as the cluster of genes located together on the…

Q: A protein X binds Ligand Y. The kon characterizing this binding is 1 x 106 M-1s-1, koff is 2 x 10-3…

A: The Lock and key model of protein ligand binding states that the binding sites of proteins are 100%…

Q: MAKE CONNECTIONS Considering the chemical characteristics of the amino acidsvaline and glutamic acid…

A: Valine is a hydrophobic, aliphatic amino acid that prefers substitution with other similar amino…

Q: To construct an “interactome” like the one shown in Figure 9-21, scientists identify all of the…

A: In molecular biology, interactomes is defined as the whole group for molecular interactions in a…

Q: What are SNARES and where are they found? Briefly describe the role they play in protein targeting

A: SNARE proteins are a specialised group of proteins involved in vesicle fusion with the target…

Q: When a chromophore binds to proteins, the binding site is generally more hydrophobic than the…

A: Proteins are linear heteropolymers of amino acids attached via peptide bonds. Proteins play an…

Q: EVOLUTION CONNECTION Identify the evolutionarymechanisms that might account for the origin…

A: The cell-to-cell signaling in prokaryotes worked for their self-defense, locations, adaptations, and…

Q: Polymerase with H2N-...GMMTVPPKKKRVGMMTV...-COOH Provide the amino acid sequence of the signal…

A: The amino acid sequence of the signal peptide is-…

Q: coded for oxyte Based on your pases would h oxytocin?

A: Oxytocin could be a cyclic nonapeptide hormone with aminoalkanoic acid sequence CYIQNCPLG that…

Q: Q2. Consider a protein that contains an a-helix with 60 residues. (a) How long is this a-helix (in…

A: Proteins are linear unbranched polymer of amino acids. They have four different levels of structural…

Q: Two ligands bind to the same site of a protein. However, when examined by ITC, for one of the…

A: Ligand binding to the receptor site or here it will be the active site depends on same specific…

Q: Problam4: Write the name of atleast 2 protein separation technique and explain any one of them…

A: Following are the methods of proteins separation:-  1. Ultracentrifugation 2. Salt fractionation 3.…

Q: Draw (using Haworth projections) the fragments of xylan and glu- comannan structure

A: Glucomannan is a mainly linear heteropolymer consisting of β-1,4-linked d-mannose and d-glucose.…

Q: 3. Which one of the protein secondary structures proposed by Corey and Pauling is stabilised by…

A: The protein is formed by the polymerization of amino acids.  A peptide is formed due to the…

Q: What are the structural features of 7N7H (Viperin-like enzyme)? a) Must show 3D structure

A: An enzyme is a biological catalyst. it is usually protein. 'Viperin' is a member of the radical…

Q: 2.) Give one example of a trans-acting regulatory protein.

A: In context of transcription, a trans-acting element is usually a DNA sequence that contains a gene.…

Q: Answer for each 1, 2, 3, 4 and 5 labelled in the attached image: a)What is this molecule? b)What…

A: Answer: PROTEINS : These are the macromolecules which are needed by an individual. These are the…

Q: Practice drawing the structures of adenine, adenosine, and adenylate.

A: Nucleotides is composed of nitrogen containing base pair linked to a sugar and a phosphate group.…

Q: Which feature of protein folding is NOT accurate?

A: Proteins perform a variety functions within organisms, including catalysing DNA…

Q: Why do we need to identify and determine the function of every single molecule involved in cell…

A: Cell signalling is the signalling events in cell that involves series of molecules which carry…

Q: For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase…

A: Beta galactosidase is an enzyme which breaks the disaccharide lactose to produce galactos and…

Q: Identify a peptide bond, the N-terminus (amino-terminus) and C- terminus (carboxyl-terminus) of a…

A: Hi. Since you have asked multiple questions. We are answering the first two for you. Please…

Q: Review how the signal-recognition particle (SRP) and SRP receptor guide proteins containing an ER…

A: The signal recognition particle (SRP) is an abundant, cytosolic, uniformly preserved…

Q: 2 A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by ligan by…

A: Enzymatic catalysis begins with the creation of an enzyme-substrate complex. The enzyme first binds…

Q: SIGNALS AND TARGETS. Listed below are sample polypeptides/proteins with their signal…

A: Introduction  A polypeptide is an unbranched, continuous chain of amino acids held together by…

Q: Summarize how feedback inhibition and posttranslational modifications regulate protein function.

A: Proteins are regulated by interactions among polypeptide or between the protein and other proteinsof…

Q: 5. In class we described two post-translational modifications which could be used to control…

A: The enzymes are the proteins. They are coded by the gene sequences present in the DNA. These gene…

Q: Describe how studying 3-D structures of PTGS1 and PTGS2 could help researchers design a drug that…

A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four…

Q: Exercise 1 The order of a molecule of mRNA is given like following. b. AAAUGUCAAACGAGGCCGAUCAUUAAACU…

A: Translation is the process where protein (amino acids) is synthesized from mRNA molecule that is…

Q: Briefly outline the roles of ribosome-associated chaperones,hsp70s, hsp90s, and chaperonins in…

A: Introduction: Proteins play a vital role in the structure and function of the living body. It is…

Q: True/false? if false, justify briefly Bacterial operons gather open-reading-frames that are coupled…

A: An operon is a group of few genes that are regulated under the same promoter and operator region.…

Q: Chemistry A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by…

A: [P] + [L]   →    [PL] Dissociation constant, Kd = [P] [L] / [PL] Dissociation constant (Kd) - is…

Q: summarize the role of galactose, GAL80, GAL4, GAL3 in relation to upstream activator sequence

A: An upstream activating sequence:It is also known as upstream activation sequence or UAS. It is a…

Q: Describe the path a cell surface receptor will take when being synthesized (starting at the…

A: Cell surface receptors are receptors that are located on the plasma membranes of cells. They…

Q: The three amino acids "DRY" in loop I2 are required for protein targeting. What is the name of this…

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: Two proteins, A and B, bind to the same ligand, L, with the binding curvesshown below. What is the…

A: A ligand-binding assay relies on the binding of the ligand molecules binding to proteins or…

Q: ACTIVITY 7.1.2 Write the structural formula of dATP, DTTP, DCTP, dGTP, UTP, and give the complete…

A: Introduction:  Deoxyribonucleic acid is made up of subunits called nucleotides. Each nucleotide…

Q: Plz choose all correct option and Do explain.  Which of the following descriptions about tandem…

A: The interaction of proteins is a tricky game. Interaction of proteins takes place through complex…

Q: Describe in detail with the aid of diagrams the use of chemical shift perturbation mapping to…

A: Before getting into protein-ligand binding site mapping using chemical shift perturbations, lets…

Q: How is dynamic instability regulated by GTP hydrolysis? O GTP hydrolysis promotes addition of…

A: Dynamic instability is the condition, which is possible because of GTP hydrolysis. GTP distorted the…

Q: WHAT IF? Where would you expect a polypeptideregion rich in the amino acids valine, leucine, and…

A: Polypeptide chains are made up of amino acids linked by peptide bonds. The amino acid side chains…

Q: Describe the importance of ubiquitin-dependent degradation of soluble proteins.

A: Thousands of distinct proteins are found in all living cells, each of which performs a specific…

Q: UESTION 16 Which of the following best describes the proper sequential order of the dogma of…

A:

Q: You take the PKA catalytic subunit, the regulatory subunit, and the dimerization domains and mix…

A: Protein kinase A is also called cAMP-depended protein kinase. It phosphorylates proteins when…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.