Q. Given the complicated steps necessary to convert DNA to RNA to protein and the fact that RNAs can catalyze reactions, speculate on why cells ever evolved proteins at all. Why not simply use catalytic RNAs?

Q. Given the complicated steps necessary to convert DNA to RNA to protein and the fact that RNAs can catalyze reactions, speculate on why cells ever evolved proteins at all. Why not simply use catalytic RNAs?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 22QP: Analyzing Cloned Sequences What kind of information can a DNA sequence provide to a researcher...

See similar textbooks

Related questions

Q: 97 Which of the following is examples of a transposable element found in bacteria? (multiple choice…

A: Note- we are supposed to answer three question according to our guidelines, please repost other…

Q: IV. Oswald Avery, McCarty and McLeod (Early 1940s) After Griffith's experiment most scientists…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: A terminator loop is… Group of answer choices a. A tertiary structure in DNA that causes DNA…

A: Introduction :- There are three main steps , that are present in any molecular events , like - in…

Q: Q: It has been found that some compounds, such as fungal toxins and some antibiotics, can inhibit…

A: Gene expression at the flow of information from DNA to RNA and then to proteins.

Q: II. Identify what the mRNA, tRNA and amino acid for the DNA bases below. DNA bases below can be…

A: The mRNA and amino acids sequences can be deduced by DNA sequence. The mRNA sequences are…

Q: Noncoding ribonucleic acid (RNA) interference/regulation in reguards to gene expression. Provide…

A: A human genome consists of both coding and noncoding RNAs and the population of noncoding RNAs is…

Q: Describe the findings of ribosome profiling that would show the presence of a regulatory mechanism…

A: Ribosome profiling, the profound sequencing of ribosome ensured mRNA parts, represents a powerful…

Q: 59 Walter Gilbert coined the term ( ) for an intervening sequence that is removed during the…

A: 59. Walter Gilbert coined the term Introns for an intervening sequence that is removed during the…

Q: Initiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl…

A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…

Q: ext, let's work through the 1st part of the process: TRANSCRIPTION. sing the sequence found in the…

A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA is made up of…

Q: econstruct the corresponding DNA template sequence from the partial mRNA sequence…

A: It is a double-stranded molecule made of nucleotides which are made from a nitrogenous/ organic…

Q: Determine the original polypeptide sequence that would give the following results. Amino acids…

A: Peptides are polymers of amino acids linked via a covalent peptide bond. The peptide bond formation…

Q: Describe how RNA polymerase backtracking could function to increase the fidelity of transcription.

A: Transcription of the genetic information from DNA into RNA is the central process of gene…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: 24. Use the table below to answer the following question. The template strand of a gene contains…

A: The DNA molecules are double stranded in structure . The DNA structure undergoes the process of…

Q: 1. Analyze the following and identify which one mentions the function of a common eukaryotic ligase?…

A: Ligase enzymes are enzymes of Enzyme classification class 6 and it catalyzes the formation of C-C,…

Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…

A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…

Q: a. Describe the different stages that occur during the translation process of Protein Synthesis. (b)…

A: To get the remaining sub-parts solved, please repost the complete question and mention the sub-parts…

Q: AKS 5ct: Use the chart below to answer the question that follows. Which of the models below…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: 19.Identify the single most correct choice: a) Without an exception, all enzymes are proteins. (…

A: Ans: e) b and d

Q: Explain the central dogma of molecular biology

A: According to guidelines we have to answer the first question only. So, please kindly post the…

Q: Describe in detail the process of RNAI including the major protein involved. What is the role of…

A: Biotechnology is the field that makes use of biology to solve problems undergoing the making of some…

Q: Please answer fast Explain how you would go about developing new ribozymes capable of targeting new…

A: Ribozymes are the ones that arefound to be catalytically active RNA molecules. Here, RNA is…

Q: sts?

A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…

Q: Select all that apply Choose the two nucleotides that are typically used in prokaryotes as the first…

A: The process by which double stranded DNA gives mature single strands of mRNA which is further used…

Q: Explain The Central Dogma of Molecular Biology, highlighting the process of protein synthesis.

Q: Write down the major differences between DNA and RNA.keeping in mind the concept of " central dogma"…

A: The cell possesses genetic material, which acts as a hereditary molecule and controls all functions…

Q: List consensus sequences used in DNA replication, transcription, and translation and compare between…

A: The central dogma of molecular biology describes the two-step process, transcription and…

Q: d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide…

A: we are answering D part E part is missing pls repost for E part.

Q: b) How does accuracy of aminoacylation during tRNA charging regulated to ensure fidelity of genetic…

A: Answer. The fidelity of protein synthesis depends on the accuracy of the two mechanisms: The linking…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: 3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human…

A: RT - qPCR - Quantitative reverse transcription PCR (RT-qPCR) is used when the starting material is…

Q: Which of the following processes are carried out by a Ribozyme?

A: The solution has been provided assuming option B is the last option. Ribozymes are RNA enzymes.…

Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…

A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…

Q: posted 8 months ago (last edited 5 mont Mechanism of Microbial Genetics Prior to the elucidation of…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: AKS 5c1: A section of a nucleic acid is shown in the model below. The process represented in the…

A: Nucleic acids are one of the most important biomolecules of living system. There are two types of…

Q: explain how the concentration of the N protein helps regulate the transcription of mRNA and full…

A: Viruses are microscopic living things found in a variety of habitats on earth. Mostly all the…

Q: Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give…

A: The process of translation is the process of gene expression. This process is characterized by the…

Q: So let’s review what we just did with a few questions:  What are the different types of RNA used…

A: RNA is the signal stranded nucleic acid. It is the polymer of ribonucleotide.

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Translation is process in which proteins are synthesized.

Q: A geneticist conducts the experiment outlined in Figure 15.8, but this time she combines guanine…

A: The genetic code allows deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) nucleotide sequences…

Q: 4. Please propose an experimental design to address the following hypothesis: Eukaryotic initiation…

A: DNA is transcribed to form mRNA. In eukaryotes, pre-mRNA is processed post-transcriptionally to form…

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: MRNA 1 20 ORI 40 60 TТCGAGCTCTCGТССТCGAGATACGCGATGATATTACTGGTAАТАТСGGGAТССАСТАТС…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: Q: Sort each description by the type of RNA it describes? a) contains an anticodon b) specifies the…

A: ANSWER;- option A is correct - a, b, d - tRNA, c mRNA, e, f rRNA Explain;- Sort each describes…

Q: Which of the following are conserved between bacteria and eukaryotes? Choose all at apply.…

A: It is a multiple choice question.

Q: Matching type Choices are in the picture 6. RF1 and RF2 recognize the three bases to terminate the…

A: Transcription is the process in which the DNA molecule information is copied into RNA molecule. The…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features: (a) activated precursors,(b) direction of chain elongation, (c) conservation of the template, and(d) need for a primer.
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
When Avery, MacLeod and McCarty used the enzyme __________. No bacterial transformation took place indicating that the biochemical nature of Griffith’stransforming factor is very probably ______. a)protease,protein b)DNase, DNA c)RNase, RNA d)lysozyme,components of the cell wall.
https://cancer.sanger.ac.uk/cosmic/gene/analysis?ln=TP73 using the above linke, Briefly describe the most common mutation found in this gene. Include details about the type of mutation, and the predicted effect. . where does the mutation occur, what bases are changed; does the mutation change the protein sequence, and if so what would the likely biologics consequences be?
Explain why NTPs are used in DNA synthesis, rather than NDPs?
1. For each of the processes below, fill in blanks with one or more of the items in the following list: Ligase (L), Primase (P), enzyme with 5' to 3' activity (E), RNA-dependent polymerase (RNA-DP = polymerase which uses RNA template), DNA-dependent polymerase (DNA-DP=polymerase which uses DNA template). for PCR you need............. for normal mRNA synthesis you need........ for normal DNA synthesis you need........ for normal tRNA synthesis you need....... 2. (please explain) Suppose the DNA synthesis that occurs in PCR is less accurate than cellular DNA synthesis (as in, PCR has a higher error rate than normal DNA synthesis). This difference in error would most likely be because the polymerase used in PCR: a) has a low level of 5' to 3' exonuclease activity b)has a low level of 3' to 5' exonuclease activity c) has a low temp at which it denatures d) adds to the 5' end of the growing DNA chain e) does not use template
Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts as a template for DNA synthesis: RNA directs the cutting of an RNA molecule at a precise location: RNA directs the cutting of an DNA molecule at a precise location: options: a. Small Nuclear Ribonuclear Protein (SNRNP) b. telomerase c. primase d. helicase e. CRISPR/Cas9
19.Identify the single most correct choice: a) Without an exception, all enzymes are proteins. ( b) Both 30S and 50S ribosomal subunits are needed for translation. ( c) Competitive inhibitors of an enzyme are those inhibitors that bind to a region of enzyme and force it to change conformation so the enzyme will not be able to interact with the substrate. d) Certain archaebacteria have RNA genome. e) b and d 20. the DNA of bacteriophages can get incorporated in the host DNA. True or false
So let’s review what we just did with a few questions:  What are the different types of RNA used and what are their roles?
H 20 Determine the original polypeptide sequence that would give the following results. Amino acids enclosed in parentheses are together as one strand. Commas indicate that the amino acids exist in that strand, not the order of amino acids linked together. A subscript indicates that number existing in the strand. a. Complete hydrolysis with acid: Ala2, Arg, Lys2, Met, Phe, Ser2 b. Carboxypeptidase A digestion: Ala c. Trypsin digestion (Ala,Arg), (Lys,Phe,Ser),(Lys),(Ala,Met,Ser) d. Cyanogen Bromide treatment: (Ala,Arg,Lys,Met,Phe,Ser), (Ala,Ser) e. Thermolysin digestion: (Ala), (Ala,Arg,Ser), (Lys2,Met,Phe,Ser)
What is the effect of incubating a mixture of RNA and DNA with 0.1 M NaOH? A. DNAishydrolyzedtonucleosidemonophosphates.B. No effect. RNA and DNA are resistant to base hydrolysis.C. RNA is hydrolyzed to nucleoside monophosphates. D. Both RNA and DNA are hydrolyzed to nucleoside monophosphates. Stem-loop structures in RNA resemble the ________ form of double-helical DNA. A. A B. BC. supercoiledcircular D. Z