Matching Question Regions of chromatin [Choose] where most active genes are found regions of chromatin containing few active genes, more likely to be highly compacted [ Choose] centromeres and [Choose] telomeres are.

Matching Question Regions of chromatin [Choose] where most active genes are found regions of chromatin containing few active genes, more likely to be highly compacted [ Choose] centromeres and [Choose] telomeres are.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 15P

See similar textbooks

Related questions

Q: (comprehension) A cell containing 48 chromosomes at prophase of mitosis would, at its completion,…

A: Cells are formed from the preexisting cells.

Q: Objective: To review the phases of mitosis with the understanding that in a real tissue or a…

A: As per our policy, we are answering the first question only. For the rest of the questions, kindly…

Q: b. The net protein product is significantly toxic c. The number of faulty transcript is…

A: .c. Condensins During M phase of cell cycle condensin proteins maintained chromosome in condensed…

Q: Find a drug that is currently used in cancer treatment Tell me what it is used for (e.g. any…

A: There are many drugs that can be used to treat cancer which has action of targeting DNA…

Q: 1. Which of the following statements is INCORRECT? A. For efficient compaction, DNA depends on…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 24. What is the main reason why somatic cells undergo MITSOSIS instead of Meiosis? Explain and give…

A: Answer: MITOSIS : It is the equational division during which a cell is divided in to two identical…

Q: 32. Would you expect to find hydrophobic amino acids on the external surface or internally in…

A: We are authorized to answer one question at a time since you have not mentioned which question…

Q: 26. What is chromatin? A. DNA and lipids B. RNA and lipids CDNA and protein D. RNA and protein 27.…

A: 26. Chromatin:- Chromatin is a substance within a chromosome consisting of DNA and protein within…

Q: What two items are needed to open a cell and release the DNA and then open the strands?

A: DNA is the basic unit of inheritance. There are many cytological and molecular biology techniques to…

Q: lividing cell? O the centrosomes are constantly digesting spindle fibers making it shorter pulling…

A: Mitosis is the type of cell division in which one cell is divided into two daughter cells. it…

Q: Question:- Why does the presence of chromosomal breaks (either spontaneous or from chemicals) often…

A: The chromosomes are the condensed from of chromatin in eukaryotic cells in which the genetic…

Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?

A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…

Q: SKILL EXERCISES POST-ACTIVITY 1. The E2F family of transcription factors is important in regulating…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: Question text A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CAC…

A: Transcription is defined as the process of creating an RNA copy of a gene sequence from a DNA…

Q: (warm up) Name Caitlin Myers 7-and an Periodd be ritte Ssion se DIRECTIONS: Complete each of the…

A: Central dogma is a complex process where, mainly event occurs DNA replication ( formation of new DNA…

Q: 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a…

A: Renaturation is a process of reformation of hydrogen bonds between the complementary single strands…

Q: Question:- Cells need a way of counting how many divisions they have undergone to keep track of…

A: The majority of replication errors are fixed during replication by DNA polymerase or by…

Q: POST-ACTIVITY SKIL 1. The E2F family of transcription factors is important in regulating the cell…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: Let’s suppose you have isolated chromatin from some bizarreeukaryote with a linker region that is…

A: Introduction Each human cell contains around 3 metres of DNA which contains about 3 Billion base…

Q: Solid Wire Models of Cell Division 1- Get four solid wires, 2 long (1 green and 1 red) and two short…

A: CELL DIVISION When a parent cell divides into two or more daughter cells , the process is known as…

Q: Dynamic instability causes microtubules either to grow or to shrink rapidly. consider an individual…

A: Ans: Microtubules: These forms the main part of cells cytoskeleton which are made up of alpha and…

Q: 22. If there were a nonsense mutation in the gene encoding one of the main proteins of the…

A: Given: nonsense mutation in the gene encoding one of the main proteins of the kinetochore structure.

Q: mal events in mitosis gives rise to daughter cells with exactly the same chromosome number and…

A: Cell division is an important process since it involves cell division events. A cell must keep track…

Q: 2. Give at least one example of a chromosomal structureor function affected by the following…

A: Chromosomes are the thread-like structures that possess a tightly coiled DNA molecule around the…

Q: The nuclear matrix composition: a. lamina, nucleosome b. cortex, lamina, c. nucleosome d. lamina,…

A: The nuclear matrix is described as a type of structure that majorly comprises non-histone proteins.…

Q: 24. Where in the DNA of a chromosome would you most likely find nucleosome-free regions (NFRS)? a.…

A: Nucleosome-free region (NFRs) at the 5′ and 3′ ends of genes are common locations for mRNA and…

Q: Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: PERCENTAGE COMPOSITION OF WATER INSIDE THE CELL? IT SURROUNDS THE CHROMATIN AND NUCLEOLI? DOUBLE…

A: Living things contain both organic and inorganic molecules. In living organisms, most of the…

Q: Exercise 2- Mitosis in Plant Cells. 1. Label Figure 2 with phases of mitosis. Determine the diploid…

Q: (comprehension) If the liver cells of some animal have 32 chromosomes, HOW MANY chromosomes do its…

A: A chromosome is a lengthy DNA molecule that contains part or all of an organism's genetic…

Q: Learning Task 6: Matching Type : Match column A with column BColumn A 1. translocation Column B a. a…

A: Translocation : ( c) A piece of chromosome breaks off and attaches to another chromosomes.…

Q: * 14. In table form, compare prokaryotic and eukaryotic cells with respect to sıze, plasn DNA…

A: Cells are the essential functional and structural units of all living beings, as we all know. There…

Q: 6) There is clear evidence that chromatin state is directly related to the ability of proteins to…

A: The chromosomes appear as a mass of greatly fine tangled string called "chromatin." Chromatin is…

Q: MODELLING HUMAN MITOISIS ACTIVITY In SOMATIC CELLS INTERPHASE (G,> s G,) Cell membrane • Nuclear…

A: During interphase, the cell grows and the nuclear DNA is duplicated

Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu

Q: Time (h) 1 3 6 12 Mouse thymus cells were treated with 10 micromolar dexamethasone to induce…

A: Chromatin is defined as the complex of DNA and protein which forms chromosomes inside of the nucleus…

Q: Question:- When mapping sequence reads to a reference chromosome, discuss the parameters that…

A: A collection of sequences without any genomic context are the result of sequencing. The sequences'…

Q: What are the different structural organizations during packaging of DNA in a eukaryotic cell? What…

A: DNA is a long chain of nucleotides that contain the complete biological information of organisms. A…

Q: The double-stranded molecule of DNA: AG/TC is a very good representation of the much larger…

A: There are a total of 5 bases of which nucleic acids are made up that are Adenine (A), Thymine (T),…

Q: If a nucleus has 12 chromosomes during interphase,how many chromosomes does it have during…

A: mitosis is a form of cell division in which the parent diploid cells divided into two daughter cells…

Q: post-mitotic in adults. Human lifespan m iltimately be limited by this: trade-off, .pleiotropy,…

A: Post mitotic is referring to cells (for example, neurons) that doesn't exhibit mitosis and cell…

Q: 18 During the S phase of the cell cycle, ONE member of each homologous pair of chromosomes is…

A: S phase (Synthesis Phase) is the phase of the cell cycle in which DNA is replicated. This phase…

Q: Praeuce problem Using the diagram from the Cell Cycle lesson, 12 we can practice calculating a…

A: Cell division is a process of a parent cell replicating it chromosomal content and dividing itself…

Q: Arrange the levels of chromatin packing from most "open" to most condensed (chromosome, loops,…

A: Chromatin is a complex combination of DNA and proteins that makes up the chromosomes within the…

Q: discontinuous? 10. Shown here is a Holliday junctionWhich cut and resolution will result in…

A: Introduction :- Recombination is the exchange of segments of chromosomes during crossing over . It…

Q: DNA ISOLATION IN FRUITS 1. How do you minimize the interaction between DNA and histones in the…

A: Introduction: The nucleosome complex of DNA folded over a histone protein octamer sorts out the…

Q: a)Discuss or explain the consequences for a cell if the chromatin could not be remodeled. (b) Does…

A: Central dogma of molecular biology states that DNA is replicated via DNA replication using the DNA…

Q: In Figure 12-11b, in what chromosomal region are youlikely to find the most H1 histone protein?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Concept explainers

Sleep Physiology

Sleep is a condition of reduced muscle movement in the body. Awareness about the surroundings is reduced at the time of sleep. The body stays mildly responsive or non-responsive to external stimuli. The sleep-wake cycle is controlled by the circadian rhythm that produces a resting phase for the body.

Question

options for all 3 are euchromatin and heterochromatin

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an â€œaverageâ€� human chromosome?
Question:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.
Let’s suppose you have isolated chromatin from some bizarreeukaryote with a linker region that is usually 300–350 bp inlength. The nucleosome structure is the same as in other eukaryotes.If you digested this eukaryotic organism’s chromatin with ahigh concentration of DNase I, what would be your expectedresults?
Question:- When mapping sequence reads to a reference chromosome, discuss the parameters that determine whether a read maps to a specific chromosomal location ?
Question: Explain how epigenetic marks and genomic imprinting are related. Provide a drawing to illustrate your point.
Animal and plant cell prophase similarity? Animal and plant cell Metaphase similarity? Animal and plant cell Anaphase similarity? Animal and plant cell Telophase similarity? 1. Explain why we used these particular cells to map the phases of mitosis (Whitefish blastula and Onion Root Tip). Why do these cells best demonstrate the phases of mitosis?
Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.
Telomere position effect (TPE) alters the gene expression in yeast cells? why?
4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragments
6) There is clear evidence that chromatin state is directly related to the ability of proteins to initiate gene transcription. Compare and contrast euchromatin to heterochromatin in the context of transcription. Specifically comment on DNA and protein interactions.
Polarity of oocyte of DrosophilaWhat are the cells surrounding the oocyte? Are they germ-line or somatic in origin?
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.