SKILL EXERCISES POST-ACTIVITY 1. The E2F family of transcription factors is important in regulating the cell cycle and has a role in cancer. These DNA binding proteins have conserved helix-turn-helix motifs that interact with DNA (NOTE: The DNA is represented as a stick diagram, whereas the protein is represented as helical ribbons.) Consider the protein a helix indicated by the arrow. This helix is approximately 16 amino acids in length and runs along side the DNA. Suggest a sequence for this 16 amino acid helix and provide a justification for your answer. Picture from Meinhart, A. et al. J. Biol. Chem. 2003;278:48267-48274 (used by permission). DNA View this skill exercise as an opportunity to practice scientific argumentation. Therefore the justification will be the most important aspect of your answer.

SKILL EXERCISES POST-ACTIVITY 1. The E2F family of transcription factors is important in regulating the cell cycle and has a role in cancer. These DNA binding proteins have conserved helix-turn-helix motifs that interact with DNA (NOTE: The DNA is represented as a stick diagram, whereas the protein is represented as helical ribbons.) Consider the protein a helix indicated by the arrow. This helix is approximately 16 amino acids in length and runs along side the DNA. Suggest a sequence for this 16 amino acid helix and provide a justification for your answer. Picture from Meinhart, A. et al. J. Biol. Chem. 2003;278:48267-48274 (used by permission). DNA View this skill exercise as an opportunity to practice scientific argumentation. Therefore the justification will be the most important aspect of your answer.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 18P

See similar textbooks

Similar questions

IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
Need help. Contrast DNA replication with gene expression (transcription→translation)—when does each occur? What molecules are involved? How much of the DNA is utilized?
Disdis -how do RB and p53 negatively regulate the cell cycle in G1? describe the events that occur in the initiation and elongation of DNA replication in S phase.
Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists of the following sequence of bases: AUGCCAGGUUAUGUCUAG. a. What sequence of amino acids would this translate to? b. Now suppose that a mutation takes place in the DNA so that twelfth base changes from U to G. How does this change the meaning of the 4th amino acid? (I.e., what does it change to?) c. Would the result be a normal protein? EXPLAIN SPECIFICALLY WHY OR WHY NOT.
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
Q: on Transcription process Briefly describe the differences in the transcription and translation processes as they occur in prokaryotic cells and eukaryotic cells. Thank you very much for your help.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
Cells go to great length to correctmistakes in the processes of DNAreplication, transcription, splicing,and translation. Are there analogousstrategies to correct mistakes in theselection of which genes are to beexpressed in a given cell type? Couldthe great complexity of transcriptioninitiation in animals and plants reflectsuch a strategy?
How alternative splicing partially explainswhy the diversity of human proteins vastlyexceeds the number of human genes
Effects of BPA on phosphorylation of MAPKfamily in RAW264.7 cells conclusion
Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.