Homework Help is Here – Start Your Trial Now!
Science
Biology
(warm up) Name Caitlin Myers 7-and an Periodd be ritte Ssion se DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must ranscribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). TOUE. 1. ATGCATGCG CGACTGGGGTCGGAGTGG. STACQTACQCACTRA CC CCAQTETO ACC ca ata MRAA-7 AUG CA aca caA od ans Eug y peg ede ye eiy Trb Protein met. Ala. usletion Yau. EV 2. ATGGTACAGAAAAGTTIIGG AG TACCA TOTC MENA-) TGTCC AGGTACGTCGTA AGAGATC

(warm up) Name Caitlin Myers 7-and an Periodd be ritte Ssion se DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must ranscribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). TOUE. 1. ATGCATGCG CGACTGGGGTCGGAGTGG. STACQTACQCACTRA CC CCAQTETO ACC ca ata MRAA-7 AUG CA aca caA od ans Eug y peg ede ye eiy Trb Protein met. Ala. usletion Yau. EV 2. ATGGTACAGAAAAGTTIIGG AG TACCA TOTC MENA-) TGTCC AGGTACGTCGTA AGAGATC

Biochemistry
Biochemistry
6th Edition
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Reginald H. Garrett, Charles M. Grisham
Chapter17: Metabolism: An Overview
Section: Chapter Questions
Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...
See similar textbooks
icon
Related questions
Question
100%
Natte को irvicle ie wnd te the following DNA Olympics eralls a od come odents, at wy h wy ed ip the ar (warm up) y and anawers e Period a Name Caitlin Myers be writtenin usion sentena DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). our. thin 1. ATGCATGCGCGACTGG G G TC GGAGTGG 5TACaTACacaCTQACC CCAQCETCACC 31 MRAA -7 AUG CA aca ca4 Eug pca atq yeg sletion Yeu. eiy Ser. HiS. Protein AGI TTC 2. ATGGTACAGAA A A -ACCAT AAGITIIS MRNA- 3. ATGTGTCCAGGTACGTCGTAAGAGATC rotcin is actually a very long molecule composed of many hundreds or thousa Idod on itself many times to create a complicated, three-din
Transcribed Image Text:Natte को irvicle ie wnd te the following DNA Olympics eralls a od come odents, at wy h wy ed ip the ar (warm up) y and anawers e Period a Name Caitlin Myers be writtenin usion sentena DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). our. thin 1. ATGCATGCGCGACTGG G G TC GGAGTGG 5TACaTACacaCTQACC CCAQCETCACC 31 MRAA -7 AUG CA aca ca4 Eug pca atq yeg sletion Yeu. eiy Ser. HiS. Protein AGI TTC 2. ATGGTACAGAA A A -ACCAT AAGITIIS MRNA- 3. ATGTGTCCAGGTACGTCGTAAGAGATC rotcin is actually a very long molecule composed of many hundreds or thousa Idod on itself many times to create a complicated, three-din
Expert Solution
steps

Step by step

Solved in 4 steps with 4 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS