(Met pro UAC GGG AUGCCCACG UAG MŘNA a. 5' and 3' ends of the mRNA b. A, P, and E sites c. Start codon d. Stop codon e. Amino and carboxyl ends of the newly synthesized polypeptide chain f. Approximate location of the next peptide bond that will be formed g. Place on the ribosome where release factor 1 will bind

(Met pro UAC GGG AUGCCCACG UAG MŘNA a. 5' and 3' ends of the mRNA b. A, P, and E sites c. Start codon d. Stop codon e. Amino and carboxyl ends of the newly synthesized polypeptide chain f. Approximate location of the next peptide bond that will be formed g. Place on the ribosome where release factor 1 will bind

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

A. rRNA is used to transfer amino acids to the ribosome. make up the large ribosomal subunit. make up the subunits of a ribosome. make up the small ribosomal subunit. B. When the full ribosome has bound to mRNA for the first time, the first codon (start codon) of the mRNA is in which site? It varies. P E A
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a stop codon.
Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that comprises the transfer RNA b) mRNA transcript just after transcription c) polypeptide chain released by ribosome d) mRNA transcript that a ribosome attaches to
A protein has the sequence of amino acids shown below. Construct a mRNA molecule that could code for this protein: Phe Ala Met Ser Thr Leu Val
An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminal and carboxyl-terminal ends.
An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different
An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and carboxyl-terminus.
Which of the following amino acid changes could result from a mutation that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result. a. Leu → Gln b. Phe → Ser c. Phe → Ile d. Pro → Ala e. Asn → Lys f. Ile → Asn
The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA codons that correspond with this sequence , and then give the sequence of amino acids in the polypepide
A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)