Molecules involved in DNA replication A. DNA Polymerase I B. DNA Polymerase II C. Single strand binding proteins D. Helicase E. DNA Ligase F. Primase Match each of the molecules with their specific role in DNA replication. NOTE there is only one correct molecule for each role. 1 Unwinds the helical structure of DNA and separates the two strands Prevents the two strands from reforming hydrogen bonds with each other 3 Synthesizes a short fragment of RNA to serve as a starting point for DNA replication Synthesizes most of the new DNA by using the complementary strand as a template 5 Replaces short RNA fragments with DNA Forms the final covalent bonds to make each strand of DNA a contiguous monomer of nucleotides

Molecules involved in DNA replication A. DNA Polymerase I B. DNA Polymerase II C. Single strand binding proteins D. Helicase E. DNA Ligase F. Primase Match each of the molecules with their specific role in DNA replication. NOTE there is only one correct molecule for each role. 1 Unwinds the helical structure of DNA and separates the two strands Prevents the two strands from reforming hydrogen bonds with each other 3 Synthesizes a short fragment of RNA to serve as a starting point for DNA replication Synthesizes most of the new DNA by using the complementary strand as a template 5 Replaces short RNA fragments with DNA Forms the final covalent bonds to make each strand of DNA a contiguous monomer of nucleotides

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 8P: Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second...

See similar textbooks

Similar questions

Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA. What are these 3 proteins and is there an helpful way that can I remember what each of thier functions are?
The reaction in DNA replication catalyzed by DNA ligase isa) Addition of new nucleotides to the leading strandb) Addition of new nucleotide to the lagging strandc) Formation of a phosphodiester bond between the 3’-OH of one Okazaki fragment and the 5’-phosphate of the next on the lagging strandd) Base pairing of the template and the newly formed DNA strand
Mama: ‏Compare and contrast the major similarities / differences between DNA synthesis on a leading and on a lagging strand . In your answer , you should address the directionality of DNA synthesis and the consequence on the two growing strands . Also , be Eure to include the enzymes involved in prokaryotic DNA replication .
Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicase
Please help me please! Thank you so much make a flowchart to show how DNA replication happens to identify the different enzymes needed in replication. There must be at least five (5) of these enzymes and list them with a corresponding function during DNA replication.
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
"DNA repair mechanism all depend on the existence of two copies of the genetic information, one in each of the two homologous chromosomes" is true or false.
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
DNA replication ATGGATCAGHTCCAGGGTACCCA what would the new strand look like