Help please flow Chart of mutagenesis.325Repliatonerorsmutatin.2.3.4.5.6.incorectpairBenign tumerDNA damy by mutagansPerminent chann to'NR sequenceNo change to DNA seqund- ProliferationMetastasis-The cell atempts to repair the DNA-Correct' repair

DNA The genetic material which carry information from one generation to next generation it is made…

Answered: muta. nesis

Science

Biology

muta. nesis

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 19QP: Our bodies are not defenseless against mutagens that alter our genomic DNA sequences. What...

See similar textbooks

Related questions

Q: Explanation of TPO.

A: TPO=Thrombopoietin

Q: esponse me.

A: As we know The fraction of inspired oxygen, which denoted with a capital "I". It is also the molar…

Q: ught into llowing a

A: The suprascapular notch, also known as the scapular notch, is located just lateral to the base of…

Q: modified stem

A: Numerous plants modify different parts of themselves for better sustenance in their environment.…

Q: icregion:

A: Hi! Since you posted many questions, we will be answering the first for you. Please post the other…

Q: Medical temonolgy

A: Medical terminology Terminology includes a group of words related to subject area. It is essential…

Q: TUMOR SITE CAUSED BY THE FOLLOWING CARCINOGENS - (cadmium, arsenic, aflatoxin, nitrites, and…

A: Question - TUMOR SITE CAUSED BY THE FOLLOWING CARCINOGENS - cadmium arsenic aflatoxin nitrites…

Q: EPITHELIUM IN NO

A: Epithelium is refers to layers of cells that line hollow organs and glands.

Q: Mitosis: Events

A: During mitosis, a cell duplicates all of its contents, including its chromosomes, and splits to form…

Q: indented dichotomous key

A: Dichotomous key : A dichotomous key is an important scientific tool which is used to identify…

Q: Genes

A: DNA stands for Deoxyribnucleic acid. It is the geentic material present in the nucleus in eukaryotic…

Q: Trait

A: Given question is from genetics. Genotype for flower - TT, Tt, tt Genotype for the animal - hh, HH,…

Q: Smokeless tobacco

A: Ans- Smokeless tobacco Has most of the same harmful effects ingredients as other tobacco products.…

Q: resonance structures !

A: Ozone is also called a trioxygen molecule. The formula for ozone is O3. It has a pungent smell and…

Q: H-bonds a

A: Beta pleated sheet is a type of secondary structure. It refers to local folding within the…

Q: The pinna:

A: The question is based on sense organ ear.

Q: ree-letter and one-letter n

A: Introduction Amino acids are the structure obstructs that structure polypeptides and eventually…

Q: nswer the first one :-

A: A beaker is a cylindrical jar with a flat bottom used in laboratory apparatus. As seen in the…

Q: FAILURE TO THRIVE

A: Failure to thrive is a descriptive term and is not actually a diagnostic term. This term is used…

Q: Lable the components

A: The heart pumps the blood which is rich in oxygen and the lungs which are located sideways helps the…

Q: Mitosis

A: Mitosis is an equational division that leads to the production of genetically identical cells.

Q: DNA

A: Answer--

Q: Kelivn plank statement?

A: The Kelvin-Planck statement is a combination of Lord Kelvin's and Planck's assertions. These…

Q: EPITHELIUM.

A: The epithelium is a type of body tissue that forms the covering on all internal and external…

Q: Label name only

A: We know that Teeth help us to chew food that would be large enough to swallow. Teeth also help us to…

Q: antibiotic resistance

A: Resistance to antibiotics develops when germs such as fungi and viruses develop the ability to…

Q: 20 2

A: Microscope : This is an image of simple microscope, that has a magnifying glass that has double…

Q: Penicillin:

A: The small, unicellular, and mostly prokaryotic organisms are called microorganisms. They are of…

Q: Biochemistry Laboratory Repe

A: 1. Blood glucose level of patient is only 58 mg/dl which means patient has hypoglycemia.…

Q: Definition of IP3

A: Cell signaling is the process of communication between cells. It occurs with the help of various…

Q: active site

A: Enzymes are proteins, which act as biological catalysts thereby accelerating chemical reactions in…

Q: TRNA:

A: Transfer RNA It is type of RNA that helps in the synthesis of protein. It decode a messenger RNA…

Q: secretory cells у с

A: Definition of Secretion : The substance produced or released by a gland or a cell is called…

Q: leptin i

A: Erythropoetin is a hormone which is responsible for the production of RBC

Q: Chemiosmosis

Q: Adipose tissue ose

A: Adipose tissue is a type of loose connective tissue, which store fat deposites inside the adipocyte…

Q: seminal vesicle

A: The given figure is of male reproductive system. In this figure the highlighted structure options…

Q: ses, tapirs, rhino-

A: A phylogeny or the phylogenetic tree is a diagrammatic representation of the evolutionary descendent…

Q: pink = assortin

A: The accompanying Punnett Square shows the genotype of F1 age: AbD abD abd AabbDd aabbDd …

Q: O C. conditioning

A: The correct option is Option C . Conditioning

Q: Identification

A: The action of regulating salt and water balance (osmotic equilibrium) through barriers in the body…

Q: м М

A: Heart block is a condition in which the heart rate is a very slow with abnormal rhythm.

Q: The hallux

A: Toes are each of the five digits on the end of the foot.

Q: Steps or measures in order to see a bacteria under a microscope clearly

A: Bacteria are generally small unicellular prokaryotic organisms found in every environmental…

Q: (small intestine)

Q: Tests for Proteins

A: Ninhydrine Test : Ninhydrine test is biochemical test to determine the presence of primary/secondary…

Q: low-fat diet right from ti

A: Fats are a kind of nutrient found within the food which is utilized by the body to develop nerve…

Q: mutation

A: Genes encode proteins and proteins dictate cell function. Mutation creates slightly different…

Q: Bardenpho process

A: Microbiology is a branch of biology in which we studied microorganisms like bacteria fungi and…

Q: bility one of

A: A selectively permeable membrane is one that only enables certain chemicals and molecules to enter…

Concept explainers

Environmental health and hazards

An organism's environment is the environment in which it lives and has an impact on its well-being. The World Health Organization (WHO) defines environmental health as "those aspects of public health, such as quality of life, that are influenced by physical, chemical, biological, social, and psychosocial components in the environment." Environmental health is concerned with both natural and man-made settings in order to enhance public health. Environmental science, occupational medicine, toxicology, and epidemiology are the key subdisciplines of environmental health.

Question

100%

Help please

flow Chart of mutagenesis.
325
Repliaton
erors
mutatin.
2.
3.
4.
5.
6.
incorect
pair
Benign tumer
DNA damy by mutagans
Perminent chann to'NR sequence
No change to DNA seqund
- Proliferation
Metastasis
-The cell atempts to repair the DNA
-Correct' repair

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
gene cloning of amplified gene with enzmes
Ten example of Human protein in therapeutic genetic technology that have available in genetic engineering and their treatment
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
need help. For both question 20. The proofreading ability of DNA polymerase which depends on its native exonuclease activity occurs in the: A. 5' to 3' direction B. 3 to 5' direction 21. Direct repair mechanisms in plants involve the enzyme: A Photolvase B. Convertese C. Hydrolase D. Phosphodiesterase
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: