IDENTIFY THE MUTATED mRNA, AMINO ACID, AND THE TYPE OF MUTATION OCCURRED ON NORMAL DNA. 2. What are the functions of the start and storTIC &Tart codon marks theste at wIch translationPART D. Directions: Identify the mutated mRNA, amino acid, and the typethe normal DNA, Use the Figure 2. Codon Table.of mutation occurred oninsto C1. Normal DNA: TAC-CCC-GT C-ACC-GC C -TAT-ATCNormal mRNA: AUG - GLLNormal Protein:2. Mutated DNA: T AC -CCC-GTC-CAC-C GC - C TA-TAT-CMutated mRNA: AUC cCt CAê GoMutated Protein: mat AM MAType of Mutation:3. Mutated DNA: TAC-CCC-GTA- CCG-CCT-ATA-TCMutated mRNA:Mutated Protein:Type of Mutation:4. Mutated DNA: TAC-CAC-GTC-ACC-GCC - TAT-ATCMutated mRNA:Mutated Protein:Type of Mutation:uec nc GC-COela -AUA-MAG wer the following questions below.2. Fill in nitrogen base of the two strandsof DNA (below) all the way to the rightto make 2 complete strands of DNA.ATToTACTGIwo exact cop iesDNA?Helicasehymine (T)? guanine (G)? and cytosine (C)?or duplication?in human genome,(7)(A)pUtine base

Name: IDENTIFY THE MUTATED mRNA, AMINO ACID, AND THE TYPE OF MUTATION OCCURR
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: IDENTIFY THE MUTATED mRNA, AMINO ACID, AND THE TYPE OF MUTATION OCCURRED ON NORMAL DNA. 2. What are the functions of the start and storTIC &Tart codon marks theste at wIch translationPART D. Directions: Identify the mutated mRNA, amino acid, and the

In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…

Science

Biology

2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated mRNA, amino acid, and the type of mutation occurred on the normal DNA. Use the Figure 2. Codon Table. 1. Normal DNA: TAC- CCC-GTC -ACC-GCC -TAT-ATC Normal mRNA: AUG -GCGCOG uG-CNela -AUA-MAG Normal Protein: 2. Mutated DNA: TAC-CCC-GTC-CAC-CGC-CT'A -TAT-C Mutated mRNA: AV sto C Mutated Protein: Type of Mutation: 3. Mutated DNA: TAC-CCC-GTA-CCG-CCT-ATA-TC 1LAIL Mutated Protein: Type of Mutation: 4. Mutated DNA: TAC-CAC-GTC-ACC-GCC-TAT-ATC Mutated mRNA: Mutated Protein: Type of Mutation:

2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated mRNA, amino acid, and the type of mutation occurred on the normal DNA. Use the Figure 2. Codon Table. 1. Normal DNA: TAC- CCC-GTC -ACC-GCC -TAT-ATC Normal mRNA: AUG -GCGCOG uG-CNela -AUA-MAG Normal Protein: 2. Mutated DNA: TAC-CCC-GTC-CAC-CGC-CT'A -TAT-C Mutated mRNA: AV sto C Mutated Protein: Type of Mutation: 3. Mutated DNA: TAC-CCC-GTA-CCG-CCT-ATA-TC 1LAIL Mutated Protein: Type of Mutation: 4. Mutated DNA: TAC-CAC-GTC-ACC-GCC-TAT-ATC Mutated mRNA: Mutated Protein: Type of Mutation:

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located
1. What amino acids are specified by the following base triads on DNA?a. TCAb. CCtc. GGC d. GATe. TTA 2. What amino acids are specified by each of the following codons on an mRNA molecule? a. CAU b. UCC c. AGA d. GCG e. AAA
I’m supposed to translate tRNA into amino acids for each codon of the previous question and state what the amino acid chains become. For example: AUG AAA CGC CCA....
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons that correspondwith this sequence, and then give the sequence of amino acids inthe polypeptide.b. Provide a different