3. What type of nucleic acid does this chain of nucleotides occur? Provide the complete name using CAPITAL LETTERS. Do NOT givethe abbreviated name. *O OCH,Ow-OCH,-OCH93 pmP Type here to searchAD 40 ENGs/11/2021

Nucleic acids are macromolecules that are composed of nitrogenous bases and phosphate groups…

Answered: NOT give What type of nucleic acid does…

NOT give What type of nucleic acid does this chain of nucleotides occur? Provide the complete name using CAPITAL LETTERS. e abbreviated name. * O-OCH,

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 1SQ: Which is not a nucleotide base in DNA? a. adenine b. guanine c. glutamine d. thymine e. cytosine f....

See similar textbooks

Related questions

Q: titration curve. Match each numbered arrow on the curve (from (1) to (5)) with the appropriate amino…

A: Amino acids have two functional groups namely carboxyl and amino group. When the pH is less than pKa…

Q: Via Siiple uim least readily). H3N-CH-c-o CH2 nd CH2 CH2 CH2 NH3 #2 because of the Charges…

A: The internal composition of the cell is maintained because the plasma membrane is a selectively…

Q: In an alpha helix, the carbonyl oxygen of residuen is hydrogen bonded to the amide proton of residue…

A: In alpha helix the carbonyl oxygen of residue there is one hydrogen bonds between the oxygen bonded…

Q: triphosphates (dNTPs) or nucleoside triphosphates (NTPS).

A: Viruses are not capable of translating the proteins, thus they are dependent on host machinery for…

Q: Upload a drawing of Gly-Met-Asn-Glu-His Label the alpha carbons Label the R groups as…

A: Alpha carbon: It is the carbon connecting the amino group and carboxylic group in amino acid. Acidic…

Q: a) Draw the basic structure of a nucleotide that is found only in RNA. Use 'P' for the phosphate (or…

A: A nucleotide molecule consist of the 5 carbon sugar molecule to which nitrogen base is attached at…

Q: In the side chain of the amino acid E, there is a carboxylate group attached to the— α-carbon…

A: An amino acid is an organic molecule and consists of a basic amino group (−NH2), an acidic carboxyl…

Q: Identify the chiral carbons in -D-fructose. Identify the appropriate atom by selecting an atom and…

A: A chiral center is defined as an atom in a molecule that is bonded to four unique atoms or groups…

Q: K Name and match structure J with its function. [HINT: The structure name is a single word]

A: These structures as mentioned in the hint are of the Echinodermata phylum. These are the group of…

Q: The bond Indicated with a green arrow below Is referred to as a... bond. Check the proper term that…

A: Monosaccharides- Simple sugar molecule- having One oxygen atom and two Hydrogen atoms for a single…

Q: The pk, of the conjugate acid of guanidine is 13.6, making it one of the strongest neutral organic…

A: Guanidine(CH5N3) and conjugate acid is called the guanidinium cation, (C(NH2)+3) pka - Acid…

Q: (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a…

A: Holliday junction is a four-strand DNA nucleotide strand that is formed during genetic…

Q: Identify the base and monosaccharide used to form the following nucleosides, and then assign names.

A: A nucleoside consists of nucleobase and a five carbon sugar while a nucleotide consists of…

Q: NUCLEOTIDES Label the parts of these paired naclootides..

A: Genes are the structural and functional units of heredity that carry coded genetic information in…

Q: NUCLEIC ACID "BASE PAIRING" 1. 5'-A-T-A-A-G-G-G-G-C-T-C-3' 2. 5'-G-G-G-G-C-T-A-C-T-C-3'

A: The nucleic acid base pairing follows simple rule A pairs with T while G pairs with C i.e purine…

Q: Indicate which base is (or bases are) the complementarypaired base(s) for each of the…

A: Answer: Introduction: DNA - Deoxyribonucleic acid is a molecule that is used for storage of genetic…

Q: (a) Identify the base and monosaccharide in the following nucleotide. (b) Give the name and three-…

A: Nucleotides are the building blocks of nucleic acids which are the organic molecules that are…

Q: Amino Acid 1 Chemical Structure Physiological Significance letter letter code code

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: Describe the three components of a nucleotide

A: The genetic material in the form of DNA or RNA is composed of nucleotides. Nucleotides are attached…

Q: One of the following amino acids are doesn't found in alph-helical structure Aspartic acid Histidine

A: Secondary structure of protein is made up of alpha helix and beta pleated sheets . Alpha helix is…

Q: Which type of nucleic acid would have the sequence "ACCGAUUG"?

A: Question - Which type of nucleic acid would have the sequence "ACCGAUUG" ? A). DNA B). mRNA…

Q: B-D-2-Deoxyribose is an aldopentose component of the nucleic acid structure with its -OH grou at C-3…

A: Ribose and deoxyribose are the fundamental building blocks of nucleic acids.

Q: Base pairing means a purine bonds to a pyrimidine true False

A: Answer- There are two different types of base pairs purine and pyrimidine that have differences in…

Q: Name the following nucleotide: HN -P-0- -0-안e OH

A: Nucleic acids are the basic structural and functional units of all living organisms. They are large…

Q: A secondary structure of proteins in which the peptide has regular coils and every N-H group…

A: Local folded structures that arise within a polypeptide as a result of interactions between backbone…

Q: Using the figure below, clearly identify which numbered component corresponds}to a purine, a…

A: DNA is the hereditary material in organism , it is responsible for expressing certain traits…

Q: Which of the following base pairs with A? A. H3C. D. NH2 `NH EN `NH `NH B. NH2 E. `NH NH `NH C.

A: In DNA double helix the bases of one strand pairs with the bases of another strand. During base…

Q: NIT CH OH CH: H. CH: H CH CH: NH -COO ーC-ド HU Using the polypeptide above; How amino acids in the…

A: The polypeptide chain is composed of amino acids linked together via peptide bonds. The polypeptides…

Q: NH OH OH Which nucleotide is shown in the picture

A: A nucleoside is a glycosylamine that is a nucleotide without a phosphate group. A nucleoside…

Q: Show and explain how exactly the condensation reaction to form a nucleotide happens. Но HH HO-…

A: Nitrogen bases are of two types purines and pyrimidines. Either one molecule of purine/pyrimidine…

Q: OH

A: DNA is a long polymer of deoxyribonucleotides. Each deoxyribonucleotide is composed of deoxyribose…

Q: Adenine, cytosine, guanine, and thymineare the four nitrogenous bases found inDNA. For each…

A: DNA is made up of four nitrogenous bases-Adenine, Guanine, Thymine, and Cytosine. DNA is a double…

Q: Identify the base and sugar in each of the following nucleotides: A. CMP B. dAMP C. dTMP D. UMP

A: Nucleotides are the monomers of the polynucleotides, which form DNA and RNA. Nucleotides are acts as…

Q: Name the nucleic acid

A: DNA is deoxyribonucleic acid; it is a genetic material present in each and every living cell and…

Q: draw the hydrogen bonds for the following nucleic acid base pair: G and C

A: In nucleotides, nitrogenous bases are aromatic heterocyclic substances. Purines and pyrimidines are…

Q: The number of hydrogen bonds between the two strands of a ds oligonucleotide given the following…

Q: Nucleotides, the building blocks of nucleic acids, are made up of a calcium-containing base, a…

A: Note: We are authorized to answer one question at a time since you have not mentioned which question…

Q: Given the polypeptide chain below: Ala-Arg-Val-His-Asp-Gln 1. What kind of polypeptide is it? 2.…

A: The organic molecule is comprised of two functional groups that are an amino group and the carboxyl…

Q: Amino Acid Sequence:

A: The amino acids are the building blocks of proteins. They are small organic molecules that contains…

Q: CH 0=P-O-ÇH2 'N' ОН Н a. What is the name of the nucleotide? b. Would this nucleotide be found in…

A: Step 1 This is a base of DNA; it can be seen by the ribose sugar structure visible in the bottom of…

Q: Association of two or more polypeptides(ex. tetramer quaternary structure primary structure tertiary…

A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…

Q: Which of the following is not a component of a deoxyribonucleotide? O B-D-2'-deoxyribose O uracil O…

A: Uracil is not a component of deoxyribonucleotide.

Q: Attach an amino acid monomer below. Name of the amino acid: Abbreviated name:

A: Amino acids at the building blocks of proteins.

Q: STRUCTURE OF DNA Phosphate Nitrogenous Base Pentose Sugar Referring to the illustration above, the…

A: DNA is the geentic material. It stands for deoxyribonucleic acid. It is present in the nucleus,…

Q: Short Note on A. Phenylketonuria B. Protein Structure

A: Proteins are one of the most important macromolecules in the body. Proteins are polymers composed of…

Q: I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R This amino acid sequence forms an alpha helix. When thinking about…

A: A single polypeptide chain as given here, when folding into a tertiary protein molecule from a…

Q: Seatwork: Give the name of the followingand identify Nucleotide or nucleoside Sugar 2 NH2 но он NH2…

A: All living organisms are made up of cells, which are the most basic unit of life. They are…

Q: What is the DNA sequence for the molecule shown here? НаС, OH 0- NH, EN -0-P-o NH2 -0-P- NH2 -0-P-…

A: DNA is the nucleic acid that carries genetic material from one generation to another. The DNA is a…

Q: Part G - Disulfide bonds Based on the sequence alignment, is it possible that one or more disulfide…

A: The right answer is.. Yes, the conserved cysteine and methionine residues will form two disulfide…

Question

3. What type of nucleic acid does this chain of nucleotides occur? Provide the complete name using CAPITAL LETTERS. Do NOT give
the abbreviated name. *
O OCH,
Ow-OCH,
-OCH
93 pm
P Type here to search
AD 40 ENG
s/11/2021

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which type of nucleic acid is the following sequence, 5'GGGCCC 3' A. DNA B. RNA C. Both DNA and RNA D. Not enough information
I am in Microbiology and the question is how would I turn the following DNA strands to primary protein structure? a. TACCCGGTCAAGGACTCCATT b. TTACCGGCTCCGAATGACTTTT
1. Name the first complementary base from the 3' direction. 2. Name the fourth nucleotide from the 3' to 5' end. Use the correct/appropriate punctuations, spacing and letter case based on the nomenclature. 3. Name the second complementary base from the 3' direction.
5) How many different bases are found in DNA a) 1 b) 2 c) 3 d) 4
One species' DNA differs from others in its _______ a. nucleotides b. DNA sequence c. sugar-phosphate backbone d. all of the above
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
One species DNA differs from others in its _______. a. nucleotides c. double helix b. DNA sequence d. sugar-phosphate backbone
Which of the following is not a DNA sequence? a. TAG b. AUGAUUCT d. AAAAAAAAAA e. CGG
Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence Select one: a. DNA; TACGTTCCAA b. RNA; TACGTTCCAA c. RNA; AACCTTGCAT d. DNA; AACCTTGCAT
In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
1. Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide contains six phosphodiester linkages. b) The nucleotide at the 5 ' end contains the base guanine. c) The nucleotide at the 3 ' end contains the base guanine. d) The polynucleotide could be part of a DNA molecule. e) The polynucleotide could be part of an RNA molecule.
For each of these symbols, write out the full name of the base and of the nucleoside. Indicate which are components of DNA and which are components of RNA:a. Tb. Ac. Gd. Ce. U