-O-P-O H₂C O H₂C -O-P-O OH O O HC H OH H-N DNA polymerase [Select] RNA polymerase [Select] DNA ligase [Select ] either CMP or dCMP [Select] either TMP or dTMP [Select] either AMP or dAMP [ Select] either CTP or dCTP [Select] either GTP or dGTP [Select] H either UTP or dUTP [Select] H H OH₂C O O-P-0- H In order to complete the strand on the left, the following are needed: H OH₂C O 0-P-O H of O-P-0 H 0₂ 0-P-0-1 <> ✪ ◆ î <> The strand cannot be completed, because new nucleotides cannot be added in the direction shown [Select ]

-O-P-O H₂C O H₂C -O-P-O OH O O HC H OH H-N DNA polymerase [Select] RNA polymerase [Select] DNA ligase [Select ] either CMP or dCMP [Select] either TMP or dTMP [Select] either AMP or dAMP [ Select] either CTP or dCTP [Select] either GTP or dGTP [Select] H either UTP or dUTP [Select] H H OH₂C O O-P-0- H In order to complete the strand on the left, the following are needed: H OH₂C O 0-P-O H of O-P-0 H 0₂ 0-P-0-1 <> ✪ ◆ î <> The strand cannot be completed, because new nucleotides cannot be added in the direction shown [Select ]

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 only
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
Following base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true or False? Why? please help me explain that
Draw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?