- Oligonucleotide primer with a mismatch Gene in -Mismatch a vector (template DNA) Vector Add DNTPS, DNA polymerase, and DNA ligase. -Mismatch The DNA is introduced into a living cell, where the mismatch is repaired. GG.C CCG CTS or A site-directed mutant is made. The DNA is repaired back to the original sequence. FIGURE 21.12 The method of site-directed mutagenesis. Genes- Traits To examine the relationship between genes and traits, researchers can alter gene sequences via site-directed mutagenesis. The altered gene is intro- duced into a living cell or organism to examine how the mutation affects the organ- ism's traits. For example, a researcher could produce a nonsense mutation in the middle of the lacY gene in the lac operon. If this site-directed mutant gene was then introduced into an E. coli bacterium that did not a have a normal copy of the lacY gene, the bacterium would be unable to use lactose. These results indicate that a functional lacY gene is necessary for bacteria to have the trait of lactose utilization.

- Oligonucleotide primer with a mismatch Gene in -Mismatch a vector (template DNA) Vector Add DNTPS, DNA polymerase, and DNA ligase. -Mismatch The DNA is introduced into a living cell, where the mismatch is repaired. GG.C CCG CTS or A site-directed mutant is made. The DNA is repaired back to the original sequence. FIGURE 21.12 The method of site-directed mutagenesis. Genes- Traits To examine the relationship between genes and traits, researchers can alter gene sequences via site-directed mutagenesis. The altered gene is intro- duced into a living cell or organism to examine how the mutation affects the organ- ism's traits. For example, a researcher could produce a nonsense mutation in the middle of the lacY gene in the lac operon. If this site-directed mutant gene was then introduced into an E. coli bacterium that did not a have a normal copy of the lacY gene, the bacterium would be unable to use lactose. These results indicate that a functional lacY gene is necessary for bacteria to have the trait of lactose utilization.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Did your recombinant DNA have more than one insert? What was the orientation of the insert(s)? Make a rough map of yoir recombinant plasmid. (Edvotek Recombinant DNA Lab Module V)
I having a hard time understanding this since the both template strand in the end is the same the G in 5' -3' and G 3'-5' is it possible to replicate it? Can you explain it? Thank you so much.
An Hfr strain that is hisE+ and pheA+ was mixed with a strain thatis hisE− and pheA−. The conjugation was interrupted and the percentageof recombinants for each gene was determined by streakingon a medium that lacked either histidine or phenylalanine. Thefollowing results were obtained:Determine the map distance (in minutes) between these twogenes.
Conjugation depends on direct cell-to-cell contactbetween a donor F+ carrying either a conjugative________ (the F plasmid) or an integrated conjugativeelement (as in Hfr strains), and a recipient lacking suchan element (F−).
Pick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.
Explain how rolling circle DNA replication allows both donor andrecipient to end up with a complete copy of plasmids transferredby conjugation.
Cells exposed to ultraviolet light develop thymine dimersand visible light reverses this damage. Explain how this formof DNA repair occurs.
Using the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid was digested with the restriction enzymes PstI and EcoRV.
2. Replicate this strand of DNA:GCA TAG CAA TGC
A linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.