Which activity of E. coli DNA polymerase I is responsible for proofreading the newly synthesized DNA? 3' to 5' polymerase 3' to 5' endonuclease O 3' to 5'; exonuclease 5' to 3' polymerase 5' to 3' exonuclease

Which activity of E. coli DNA polymerase I is responsible for proofreading the newly synthesized DNA? 3' to 5' polymerase 3' to 5' endonuclease O 3' to 5'; exonuclease 5' to 3' polymerase 5' to 3' exonuclease

Name: Which activity of E. coli DNA polymerase I is responsible for proofre
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which activity of E. coli DNA polymerase I is responsible for proofreading the newly synthesized DNA?3' to 5' polymerase3' to 5' endonuclease3' to 5'; exonuclease5' to 3' polymerase5' to 3' exonuclease

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

Which of the following has 5’ to 3’ exonuclease activity? DNA polymerase I DNA polymerase III DNA polymerase I and III Helicase
the 3'____> 5' exonuclease activity of E. coli DNA polymerase III aacounts for the ____________ of polymerization A-Directionality B- processivity C-low error rate D-High speed
Which of the following reactions is required for proofreading during DNA replication by DNA polymerase III?a) 5’ to 3’ exonuclease activityb) 3’ to 5’ exonuclease activityc) 3’ to 5’ endonuclease activityd) 5’ to 3’ endonuclease activity
Which of the following is NOT a function of DNA polymerase I in E. coli?Question 1 options: A) 5' exonuclease B) polymerase C) helicase
In both leading and lagging strand synthesis, DNA replication always proceeds in a certain direction. What direction is this? Explain how oligonucleotide primers in the Polymerase Chain Reaction work (PCR)
In E. coli, the leading strand is primarily synthesized by: DNA polymerase ε DNA polymerase I DNA polymerase II DNA polymerase δ DNA polymerase III
Which of the following enzymes has 5’ to 3’ exonuclease activity? DNA ligase DNA polymerase I Telomerase Primase DNA polymerase III
DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as starting points B. methylated lipids as start points C. acetylated lipids as start points D. single stranded sequences as starting points
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
An investigator obtains a bacterial temperature-sensitive mutation that affects a step in the process of DNA replication at 42°C but not at 30°C. She grows the cells at 30°C and, upon shifting the temperature to 42°C, she discovers that Okazaki fragments accumulate in unusually large quantities. What is the likely target affected by the temperature-sensitive mutation? primase DNA polymerase III DNA helicase DNA Ligase DNA gyrase
The epsilon subunit of DNA polymerase III is responsible for its _______ activity.A-5'---->3' polymerase B- Sliding clampC-3'----->5' exonuclease activity D-5'------>3' exonuclease activity
Which of the following is NOT a function of DNA polymerase III? Group of answer choices Exonuclease activity 3'-5' DNA synthesis through mismatched bases DNA synthesis through damaged bases. Detection of mismatches