(DNMP), (DNMP), DNA polymerase I P-P DNTP Mg2+ (DNMP), (DNMP), +1 Deoxyribonucleoside triphosphates (ДATP, dTTP, GCТР, dGTP) DNA template (DNMP), and a portion of its Inorganic pyrophosphate Complement to template strand is extended by one nucleotide (n + 1) complement (DNMP), FIGURE 11.7 The chemical reaction catalyzed by DNA polymerase I. During each step, a single nucleotide is added to the growing complement of the DNA template, using a nucleoside triphosphate as the substrate. The release of inorganic pyrophosphate drives the reaction energetically.

(DNMP), (DNMP), DNA polymerase I P-P DNTP Mg2+ (DNMP), (DNMP), +1 Deoxyribonucleoside triphosphates (ДATP, dTTP, GCТР, dGTP) DNA template (DNMP), and a portion of its Inorganic pyrophosphate Complement to template strand is extended by one nucleotide (n + 1) complement (DNMP), FIGURE 11.7 The chemical reaction catalyzed by DNA polymerase I. During each step, a single nucleotide is added to the growing complement of the DNA template, using a nucleoside triphosphate as the substrate. The release of inorganic pyrophosphate drives the reaction energetically.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 2P: The Enzymatic Activities of DNA Polymerase I (a) What are the respective roles of the 5 -exonudease...

See similar textbooks

Similar questions

Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
DNA renaturation curves occasionally show three distinct phases of renaturation. In this graph, DNA renaturation is plotted against C0t (initialconcentration times time of renaturation—essentially a measure of relativerenaturation time). See Figure 21.3.(a) Identify each part of this plot that corresponds to reannealing of (1)unique sequences, (2) moderately repetitive sequences, and (3) highlyrepetitive sequences.(b) Suppose that you cloned a single-copy gene, such as the gene for dihydrofolate reductase (DHFR), into a plasmid vector and subjected it torenaturation analysis. Sketch the curve you might expect.(c) Suppose that you used reverse transcriptase to copy the ovalbumin mRNA and cloned this complementary DNA (cDNA) into a plasmid vector. Would you expect this cDNA to reanneal (1) more slowly, (2) more rapidly, or (3) at the same rate as genomic DNA? Briefly explain your answer.
DNA polymerase I (Pol I) of E. coli consists of three functional parts (domains): an N-terminal domain with 5´ to 3´ exonuclease activities required for removal of the RNA primer, a central domain responsible for 3´ to 5´ exonuclease proofreading, and a C-terminal domain with polymerase activity. Pol I is thought to simultaneously remove RNA primers and fill in the gaps that result. A group of proteins known as RNaseH also have 5´ to 3´ exonuclease activity and can thus remove RNA primers. However, they lack the other two functions observed for Pol I. Predict the ability of the following mutants to replicate DNA: (1) a strain with a mutant gene encoding Pol I such that it no longer has polymerase activity (but retains both types of nuclease activities); (2) a strain without RNaseH proteins; (3) a strain with a mutant gene encoding Pol I such that it no longer has 5´ to 3´ exonuclease activities (but retains 3´ to 5´ nuclease and polymerase activities); (4) a strain with…
Given: BamHI, cleaves after the first G: 5’ G GATCC 3’ 3’ CCTAG G 5’ AND BclI cleaves after the first T: 5’ T GATCA 3’ 3’ ACTAG T 5’ THEN -- Given the DNA shown below: 5’ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG3’ 3’TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC5’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? ii) If the DNA shown above was cut with the enzyme BclI, how many DNA fragment would you expect?
The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between correctly and incorrectly base-paired nucleotides at the 3′-terminus; properly and improperly base-paired nucleotides are cleaved at equal rates there. How can this observation be reconciled with the fact that the 3′-exonuclease activity increases the accuracy with which template DNA is copied?
Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme relative to the template?
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.