Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?

Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 17QP

See similar textbooks

Similar questions

What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.
Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question: What are controversies or ethical dilemmas surrounding this genetic technology or process?
From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
You are performing an experiment using CRISPR-cas9 to genetically modify the LacZ gene of a culture of E. coli. After you run the experiment, you decide to use gel electrophoresis to genotype the different bacterial cultures to determine if the gene editing was successful. How could your electrophoresis results confirm that the PCR was successful? And how could your electrophoresis results confirm that you successfully extracted genomic DNA from your bacterial samples?
"Whole-Genome Sequencing Is Widely Used for Sequencing and Assembling Entire Genomes". Explain this ?
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
What is the useful of the Development of highly sensitive and low-cost DNA agarose gel electrophoresis detection systems, and evaluation of non-mutagenic and loading dye-type DNA-staining reagents in modern medicine today?
What are the disadvantages of doing DNA sequencing?
what is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.
What key structural features of the DNA molecule underlie its ability to be faithfully replicated?
The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.