AUG Met ACGANALYSISANALYSIS:A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template isgiven below:Parent strand DNA:5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3DNA daughter strand:hnRNA:MRNA:original protein:mutated MRNA:mutated protein:second letterGUCUUUU PheUAU TyrUGUUGC CysUAA stop UGA stop| AUAG stop UGG TrpUUCUCCUACSerLeu UCAUUGUUAUCGGCUUCCUCAUCGUHisCACCAACUCCCGCLeuCUAProArgAССАCGAGlnCAGCUGCCGCGGAUUACUAAUAUC lleAAUAAAC AsnAAAAGCAGAAGUSerACCThrАСАAAG LySGAU ASPAUG Met ACGAGG ArgGGUUGCUGGU)GUCGCCGACGGCValGUAGCAAlaGAAGlyGGAAGluGUGGCGGAGGGGGTranslating the unmutated MRNA that was obtained after splicing, the original protein sequence will be?The original protein is [A](For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H).first letterthird letter

Replication occurs in a bidirectional manner. Always happens in the 5'→3' direction because…

Answered: Parent strand DNA:…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 15QP

See similar textbooks

Similar questions

Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
13. Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes Group of answer choices Primer Walking Positional Cloning Directional Cloning Chromosome Walking
Select all that apply: Which of these components must be added to a PCR reaction for it to produce a product?O DNA PrimersO Buffers- dNTPsO RNA PrimersO NTPSO PrimaseO Template DNAO Taq DNA Polymerase
“Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”
Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligase
A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase
Multiple Matching. Fill in the blanks with all the letters of thewords below that apply.________ site of protein synthesis________ carries the codon________ carries the anticodon________ a process synonymous with mRNA synthesis________ bacteriophages participate in this transfer________ duplication of the DNA molecule________ process in which transcribed DNA code is decipheredinto a polypeptide________ involves plasmidsa. replicationb. tRNAc. conjugationd. ribosomee. transductionf. mRNAg. transcriptionh. transformationi. translationj. none of these
How do you do this? can you explain and show me? Replication Given Original DNA strand: ATCCTAGCC. Give cDNA strand: Given original DNA strand: CGTATCCAG Transcribe: Translate: circle last anticodon: What does this mean and how do you solve I don't know how to do that.
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strand
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS

Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-CT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: