Use the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence. Lab Quiz - Module 10 - DNA &Quiz: Module 100 Checkab Quiz - Module 09 - Gel Eleinstructure.com/courses/94008/quizzes/344923/takeSecond mRNA baseAGUUUPhe UCUUAU TyrUGUCysUUC F Ucc Ser UAC M UGC (C)(S) UAA Stop UGA StopUse the 3-letter code for amino acids. If astop codon is encountered use the wordUUAUCAUUG (L) UCGUAG Stop UGG Trp (W) G"stop", without "".CUUCCUCAU His CGUA set of nucleotides in an original DNACUC Leu cCC Pro CACH) CGC Ara(P)CUA(L)CCACAA Gin CGA(R)strand reads: CTA CTC TTTCUGCCGCAG (0) cGGTranscribe this short DNA sequence:AAUAsn AGUAUUACUSerACC Thr AAC (N) AGC (S)ACA (M AAA Lys AGAArgAAG (K) AGG (R)lleAUC(1)AUAAUG Met (M ACGGUUGCUGAUGGUAspGCC Ala GAC (D) GGC GlyGUC Val(V)(A)(G)GUAGCAGAA Glu GGATranslate this short DNA sequence:GUGGCGGAG (E)GGGA mutation occurs such that the sequence now reads: CTA CTT TTTTranscribe this short DNA sequence:First mRNA base (5' end of codon)Third mRNA base (3' end of codon)UCAG UCAG DCAG PCAG

Translation is the process that is responsible for the production of proteins during synthesis.…

Use the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence.

Use the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Put the following in order from smallest to largest: nucleotide,genome, nitrogenous base, gene,…

A: A gene is an essential unit of heredity and an arrangement of nucleotides in DNA (deoxyribonucleic…

Q: The fragment of DNA in replication are called______fragments.

A: During DNA replication ,double helix is unwound and the complementary strands are separated with the…

Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…

A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…

Q: Which is the correct order from smallest to largest? 1) nucleotide, codon, gene, chromosome 2)…

A: In 1866, Mendel discovered the principle of heredity, demonstrating that genes are found in the…

Q: DNA replication is semiconservative because the ___ strand will become half of the ___ molecule. a.…

A: According to the semiconservative replication model, the two original DNA strands separate during…

Q: DNA RNA Description Function Sugar and Bases

A: DNA stands for deoxyribose nucleic acids and RNA stands for ribonucleic acid.

Q: Choose the combination of answers that most accurately completes the statement. DNA replication is…

A: Answer- DNA is semiconservative in nature, It was proposed by Francis Crick.

Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…

A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

Q: Transcription copies a _____ to a complementary _____ molecule. a. chromosome; DNA c. gene; RNA b.…

A: The gene is a basic physical and functional unit of heredity. Genes are made up of DNA.The gene is a…

Q: helps create a strand of mRNA by using DNA as a template. a. RNA polymerase b. DNA polymerase c.…

A: a.) RNA polymerase. The creation of mRNA from the DNA . This mRNA is made with RNA polymerase…

Q: If the sequence of bases in the coding strand of a DNA molecule isTAGC, then the sequence of bases…

A: Introduction The DNA/gene give rise to the formation of mRNA by the process called gene…

Q: differentiates the DNA from RNA.

A: DNA: It stand for deoxyribonucleic acid, which is a molecule that contains the instructions an…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: DNA _______________ adds an RNA primer that is complement to the template strand of DNA

A: DNA replication is the process in which DNA copies are made. it semiconservative, meaning that each…

Q: Explain the difference between the coding strand and the template strand in DNA

A: DNA is the hereditary material of the cell which serves as the blueprint for various cellular…

Q: mRNA comes from the ______________ and goes to the __________________. a. DNA, Ribosome b. DNA, RNA…

A: Step 1 RNA or ribonucleic acid is a single-stranded mixed polymer of four types of ribonucleotides,…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: Give the complementary strand of DNA to the following strand, and then the RNA strand based off the…

A: DNA is made of two strands linked together by hydrogen bonds. Complementary base pairing occurs…

Q: Select the best answer or answers from the choices given: The information sequence that determines…

A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Makes a DNA copy from a piece of RNA [Choose ] Reverse Transcriptase

A: In the method of Reverse Transcription ( RNA dependent DNA polymerase) convert Ribo nucleic acid…

Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48

A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.

Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…

A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…

Q: DNA replication is considered semiconservative because the________ strand will remain as half of the…

A: The DNA replication is the process by which the genetic material of the organism copies itself to be…

Q: When DNA is read by RNA synthase, mRNA is made. What is the name of the enzyme that reads DNA and…

A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…

Q: Illustrate the central dogma of life showing: a) codons b) Complementary strand of the master DNA c)…

A: The central dogma is the illustration in which DNA is converted into RNA and then into proteins.

Q: The process of forming RNA from DNA is called a. mitosis. b. DNA replication. c. translation. d.…

A: Transcription is the first step involved in gene expression wherein a small DNA segment is copied to…

Q: _____________ is responsible for adding new nucleotides to the DNA strand being created.

A: Two long polynucleotide chains made up of four diverse nucleotide sub units make up a DNA particle.…

Q: DNA is used to make and RNA is used to make RNA, proteins RNA, DNA Proteins, DNA Extra DNA, TRNA

A: *The answer of the question is option 1 that is RNA and Proteins. * DNA is used to make RNA and RNA…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Which process best describes the process of transcription? DNA strands open and both strands are…

A: 1. The process that best describes the process of transcription is: DNA strands open and one strand…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like?…

A: The sequence of bases on a DNA molecule GATTACA the mRNA sequence will be CUAAUGU. Option B

Q: Synthesize mRNA strands from the DNA templates

A: The DNA consists of two strand template strand and complementary strand. The molecule of DNA…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…

Q: A codon consists of _ bases and specifies which _ will be inserted into the polypeptide chain. 2,…

A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…

Q: Explain how the function of RNA differs from the function of DNA.

A: A gene is the fundamental physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Each new double helix will contain ___________ strand of DNA from the parent strand and ____________…

A: The method of replicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: new DNA molecule is precisely synthesized during the following EXCEPT? A.Trasformation B.…

A: Nucleic acid is a long chainlike molecule composed of nucleotides found in cells of all living…

Q: Choose the combination of answers that most accurately completes the statement. Which of these…

A: The largest and broadest category of all groups in the classification of life is known as domain. At…

Q: Transcription is the process by which a complementary mRNA strand is produced from one of the DNA…

A: Ans:- Complementory mRNA strand is G-A-U-G-C-U-U-G-A-C-U-G-C

Q: DNA polymerase starts adding new nucleotide at an RNA______________.

A: For the mechanism of replication of DNA, DNA polymerase is responsible, since two similar DNA…

Q: The __________ strand is made in fragments called ___________.

A: Semi-conservative replication, also known as DNA replication, is a biological mechanism that…

Q: What is the name of the building of an RNA molecule based on a DNA molecule? Transcription…

A: DNA, also known by the name of Deoxyribonucleic acid is a molecule composed of two chains that coil…

Q: Which statement correctly describes a codon? a sequence of three nucleotides that may code for one…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Choose the combination of answers that most accurately completes the statement.As a general rule,…

A: Genetic code is the sequence of triplet nucleotide sequence that was present on mRNA molecule. These…

Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…

A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…

Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:

A: Given: The code on a DNA strand reads GCGTAATGA.

Q: The product of transcription is a polypeptide. a short piece of RNA. a short piece of DNA. a…

A: The central dogma of biology explains the flow of information from genes to protein by two…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Lab Quiz - Module 10 - DNA &
Quiz: Module 100 Check
ab Quiz - Module 09 - Gel Ele
instructure.com/courses/94008/quizzes/344923/take
Second mRNA base
A
G
UUUPhe UCU
UAU Tyr
UGU
Cys
UUC F Ucc Ser UAC M UGC (C)
(S) UAA Stop UGA Stop
Use the 3-letter code for amino acids. If a
stop codon is encountered use the word
UUA
UCA
UUG (L) UCG
UAG Stop UGG Trp (W) G
"stop", without "".
CUU
CCU
CAU His CGU
A set of nucleotides in an original DNA
CUC Leu cCC Pro CACH) CGC Ara
(P)
CUA
(L)
CCA
CAA Gin CGA
(R)
strand reads: CTA CTC TTT
CUG
CCG
CAG (0) cGG
Transcribe this short DNA sequence:
AAUAsn AGU
AUU
ACU
Ser
ACC Thr AAC (N) AGC (S)
ACA (M AAA Lys AGAArg
AAG (K) AGG (R)
lle
AUC
(1)
AUA
AUG Met (M ACG
GUU
GCU
GAU
GGU
Asp
GCC Ala GAC (D) GGC Gly
GUC Val
(V)
(A)
(G)
GUA
GCA
GAA Glu GGA
Translate this short DNA sequence:
GUG
GCG
GAG (E)
GGG
A mutation occurs such that the sequence now reads: CTA CTT TTT
Transcribe this short DNA sequence:
First mRNA base (5' end of codon)
Third mRNA base (3' end of codon)
UCAG UCAG DCAG PCAG

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand is in the cytoplasm of a cell and translation is in progress. Draw and label all the necessary main players needed for translation to occur. Included in your drawing should also bee 3 tRNAs , these 3 tRNAs should represent two different forms of tRNA. MRNA 5' ------------AUG------------AGG----------GAG
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Need help answering these questions: Looking at the picture attached, Notice the indel symbol at location 296 of the query. What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted here?
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’