Pompe disease is a rare genetic condition resulting from a deficiency of the protein alpha-glucosidase. The following three mutations are among the 100+ mutations known or suspected of causing the disease. Context is provided in parentheses. Provide a brief hypothesis as to why the change would be damaging to the protein. a.) L571P (located in a helix buried in the protein interior)

Pompe disease is a rare genetic condition resulting from a deficiency of the protein alpha-glucosidase. The following three mutations are among the 100+ mutations known or suspected of causing the disease. Context is provided in parentheses. Provide a brief hypothesis as to why the change would be damaging to the protein. a.) L571P (located in a helix buried in the protein interior)

Name: Pompe disease is a rare genetic condition resulting from a deficiency
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Pompe disease is a rare genetic condition resulting from a deficiency of the protein alpha-glucosidase. The following three mutations are among the 100+ mutations known or suspected of causing the disease. Context is provided in parentheses.Provide a

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.
As we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion How do we know, based on studies of Neurospora nutritionalmutations, that one gene specifies one enzyme?
Why would the mutation Ile -> Asp be likely to destabilize a protein? Why would the mutation Ile ->Val be likely to destabilize a protein? Why would the mutation Val -> Ile be likely to destabilize a protein?
What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid, leucine, and phenylalanine? Use the threeletter abbreviations to express your answer.
Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?
Consider a mutation that results in a substitution of Cysteine (CYS) ) for Tyrosine (TYR) at position 368. What are the properties of the substituted amino acid, CYS? Does it have any special properties?
A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the same conditions. The normal and mutantpolypeptide differ by one amino acid. The fingerprints of the peptides obtained from the two polypeptides are shown below. What kind of amino acid substitution occurred as a result of the mutation? (That is, is the substituted amino acid more or less polar than the original amino acid? Is its pI lower or higher?) (Hint: Photocopy the fingerprints, cut them out, and overlay them.)
What is the expected molecular weight of the protein encoded by the sequence provided here: ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGTGATGTGAGTCTGGGCTGA
using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?
Since two 19S regulatory subunits and a 20S catalytic unit constitute the 26S proteasome, why is the proteasome numbered as 26S and not 58S? What is the origin of/reason for this number?
Explain the term posttranslational modifications?
The majority of bacterial mutations that need isoleucine also require valine for growth. Why? Which enzyme or process would be deficient in a mutant that requires solely isoleucine for growth (rather than valine)?