4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 22CTQ: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to...

See similar textbooks

Similar questions

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
DNA polymerase III and DNA polymerase I are used in DNA replication in E. coli. What are their roles?
2) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.
1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure of a pyrimidine dimer and explain why the formation of such aberrant structures results in tumor-enabling genomic instability. 2. Use your own words to define ultraviolet light. Include a comparison of naturally-occurring vs artificial UV. What is UV-A? UV-B? UV-C? Which one(s) is (are) the most damaging to DNA? Why? Which one(s) are most likely to lead to a mutation in skin cells? Why? What type of UV light is used in tanning beds?
5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of a DNA polymerase and the reaction catalyzed by ligase.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragments
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
22. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices 1. 5' TTACCGAAT 3' 2. 3′ TTACCGAAT 5′ 3. 5′ TAAGCCATT 3′ 4. 3′ AATGGCTTA 5′
4. In bacterial cells, nucleotide excision repair involves which of the following proteins?A. DNA glycosylaseB. AP endonucleaseC. photolyaseD. AlkBE. UvrABC proteins 5. If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is:A. constructiveB. semiconservativeC. conservativeD. consecutiveE. cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair?A. DNA polymerase IB. DNA polymerase IIC. DNA polymerase IVD. DNA polymerase VE. none of the above
8. What is happening to the DNA molecule in the figure? Also, discuss the types and functions of enzyme participating in this step.
3,Compare the free energy, ∆G, of A-T binding and A-C binding, which one is more negative? Does this makes sense in terms of the structure of DNA? Group of answer choices A, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is not favored in DNA helix. B, ∆G of the A-T binding is more negative than that of the A-C binding, which is consistent with the fact that A-C binding is favored in DNA helix. C, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is not favored in DNA helix. D, ∆G of the A-C binding is more negative than that of the A-T binding, which is consistent with the fact that A-C binding is favored over A-T binding in DNA helix.